Potato material and growth conditions.

The tetraploid potato variety Atlantic, known for its attractive appearance and broad adaptability, is also well suited for transgenic applications. Atlantic obtained from the International Potato Center-China Asia–Pacific Center was used in all experiments, including transgenesis. All plants, including transgenic lines, were grown in plant incubators under the following conditions: a light period of 16 h at approximately 16,000 lx, followed by 8 h of darkness. The temperature during the light phase was maintained at 21 and 20 °C during the dark phase.

Cloning of the full-length StMYB66 gene and construction of the pBWAHS-StMYB66 vector.

The full-length coding sequence of StMYB66 was amplified from the leaf cDNA of the Atlantic potato variety using NEB Q5 high-fidelity DNA polymerase in a 50-μL polymerase chain reaction (PCR). The reaction mixtures comprised 2 μL of cDNA template, 5 μL of 5× Q5 buffer, 1 μL of 2.5 mM dNTP, 1.5 μL each of forward (ATGATTGATTGGTTGGTTATT) and reverse (GGCACTCCTCCAAAGCCTATGA) primers, and 0.25 μL of Q5 high-fidelity DNA polymerase. The PCR program was as follows: initial denaturation at 98 °C for 30 s, denaturation at 98 °C for 5 s, annealing at 55 °C for 10 s, and extension over 35 cycles of 72 °C for 30 s. This was followed by a final extension at 72 °C for 10 min. PCR products were separated via 1% agarose gel electrophoresis and purified using an Monarch PCR and DNA cleanup kit (New England Biolabs, Ipswich, MA, USA). Adapter primers were added to both ends of StMYB66 using the same PCR procedure. The StMYB66 fragment and the pBWA(V)HS vector, linearized with BsaI, were assembled using the NEBbuilder assembly kit (E2621; New England Biolabs) following the manufacturer’s instructions. The resulting pBWAHS-StMYB66 construct was confirmed via Sanger sequencing (Tsingke Technology, Beijing, China).

Bioinformatic analysis of StMYB66.

The isoelectric point and molecular weight of the StMYB66 protein were predicted using the ExPASy Protparam toolset (https://web.expasy.org/protparam/). Protein domains were analyzed using the SMART tool (http://smart.embl-heidelberg.de/), and structural modeling of each domain was done using SWISS-Level structure MODEL (https://swissmodel.expasy.org/). Homologous protein sequences were identified through BLAST-p searches of the National Center for Biotechnology Information (NCBI) database. Conserved motifs among R2R3 MYB TFs were detected using the MEME Suite (http://meme-suite.org/). Protein sequences for alignment were downloaded from the NCBI, including StMYB66 and two Arabidopsis thaliana proteins, two Malus domestica proteins, and one Fragaria vesca protein. Multiple sequence alignment were conducted using DNAMAN, version 5.2.

Phylogenetic analysis of StMYB66.

StMYB66 protein sequences were aligned with those from A. thaliana, M. domestica, Arachis hypogaea, F. vesca, Solanum lycopersicum, Glycine max, Saccharum spontaneum, and Cichorium intybus using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/). Phylogenetic trees were constructed using the neighbor-joining algorithm in MEGA with bootstrap values based on 1000 replicates to assess tree topology and consistency (Liu et al. 2023).

Analysis of motifs present in StMYB66 promoters.

The StMYB66 promoter region was identified by aligning cDNA sequences to the potato reference genome (DMs 1–3 516 R44) using BLAST-N (NCBI). Promoter sequences, extended upstream by 2 kb, were analyzed for motifs using JASPAR CORE tool (https://jaspar.elixir.no) with an 80% relative profile score threshold.

Generation of StMYB66 overexpression lines.

Frozen (−80 °C) Agrobacterium tumefaciens harboring pBWA(V)HS-StMYB66 plant expression binary vector (V) was thawed and cultured in YEP lipid medium at 28 °C with shaking at 150 rpm. The cells were centrifuged, resuspended in infection medium (4.43 g/L MS basal medium with vitamins, 20 g/L sucrose, pH 5.5, 100 mg/L acetosyringone), and adjusted to an optical density at 550 nm (OD₅₅₀) wavelength of ∼0.5. Potato explants were immersed in the bacterial suspension for 20 min with gentle shaking and transferred to COA medium (4.43 g/L MS basal medium with vitamins, 20 g/L sucrose, 80 mg/L acetosyringone, 1 mg/L zeatin, 2 mg/L 1-Naphthaleneacetic acid (NAA), 8 g/L agar, pH 5.8). After 2 d of cocultivation in the dark at 21 °C, the explants were transferred to selection medium containing 50 mg/L kanamycin. Regenerated shoots (≥5 cm) were transferred to MS30 medium for rooting.

Reverse transcription–quantitative PCR analysis of StMYB66 expression in transgenic lines.

Total RNA was extracted from transgenic and wild-type potato leaves using the Yisheng MolPure plant RNA kit. cDNA was synthesized from 2 µg of RNA using NovoScript Plus All-in-one SuperMix. Relative StMYB66 expression levels were quantified via reverse transcription–quantitative PCR using EF1α as the reference gene. The comparative Ct method (2−ΔΔCt) was employed to calculate fold changes. PCRs (20 μL) consisted of 10 μL of SYBR quantitative PCR Master Mix, 0.4 μL of up/downstream primers (10 μM), 1 μL of RNA, and 7.8 μL of RNase-free water. The reactions were run in triplicate. The primers sequence are shown in Supplemental Table 1.

Phenotypic analysis of transgenic lines.

Phenotypic traits of the Atlantic cultivar and two overexpression lines (T01 and T16) were assessed after in vitro subculturing in MS30 medium under controlled growth conditions (21 °C/20 °C, 16 h of light/8 h of dark. After 4 weeks, shoot and root lengths were measured with a ruler, and weight was recorded using a balance. Stem color was evaluated after 2 months of subculturing.

Leaf samples collection, RNA sequence and gene functional enrichment analysis.

The healthy leaves on the top of the canopy were selected; three leaves per plant of eight plants for Atlantic and OE-T01, respectively, were selected for transcriptome research. There are four replicate samples per line. Leaf samples were stored in RNAlater (Thermo Fisher Scientific Inc., Waltham, MA, USA) immediately after collection. Leaf total RNA was extracted by TRIzol solution following the manufacturer’s protocol.

RNA sequencing was completed by Majorbio biotechnology company (Shanghai, China) with the Illumina sequencing platform. Paired-end sequencing with each read length 150 bp was used. Clean reads (filtered out reads with an adapter, N ratio greater than 10%, all A-base, mass value Q ≤ 30, and bases accounting more than 50% of the entire read) and sequence data quality were obtained and maintained by the fastp tool. In the GenBank DNA sequence database of NCBI, the ribosome database was generated by obtaining the sequence with rRNA keywords in the annotation by searching for the genus name of potato. These clean data were aligned to the potato reference genome (DM8.1) by HISAT2 (Yang et al. 2023), in which transcript was reconstructed by Stringtie, calculated expression levels of all genes in each sample. DESeq2 software (version 1.20.0), ran with R (version 3.6.0) in Rstudio was used to analyze the different expression genes. Normalized read counts, calculated P value according to model, obtained the false discovery rate value by multiple-hypotheses testing corrections. The gene expression levels were calculated using fragments per kilobase of exon per million fragments mapped. Genes with a P value < 0.05 and |log2 FC| > 1 were screened as differentially expressed genes (DEGs). DEGs were mapped to the Gene Ontology (GO) database (version 3.8.2, http://www.geneontology.org/). The list of genes in each term and the specific GO functions with the number of genes were obtained.

Statistical analyses.

One-way analysis of variance was used to determine significant differences between genotypes while Student’s t tests (*P ≤ 0.05) were used for pairwise comparisons. Statistical analyses were performed using SPSS (version 17.0) software.

Phylogenic identification of AtMYB88 and AtMYB124 homologs in potato.

To identify potato homologs, we first aligned StMYB66 with five other proteins, including AtMYB88 and AtMYB124 from A. thaliana, MdMYB88 and MdMYB124 from M. domestica Borkh, and FvMYB82 from F. vesca. We found that these proteins are highly conserved in their predicted R2 and R3 MYB DNA-binding domains (Fig. 1A). Notably, conserved amino acids were identified near the C-terminal region, marked in dark blue, confirming their association with the R2 and R3 MYB DNA-binding domains. Additionally, residues conserved between StMYB66 and AtMYB88, AtMYB124, MdMYB88, and MdMYB124 proteins, shown in pink, were greater in number compared with those conserved with FvMYB82. This difference was especially pronounced near the N-terminal region, underscoring variation across the proteins. These findings indicate that StMYB66 shares close conservation with AtMYB88, AtMYB124, MdMYB88, and MdMYB124.

View Figure

• Download as Powerpoint
• Download Figure

To explore evolutionary relationships, we performed a phylogenetic analysis based on the MYB TF domain sequences. A phylogenetic tree was constructed using 12 full-length MYB TF protein sequences (Fig. 2), including two from A. thaliana (AtMYB88 and AtMYB124), three from M. domestica Borkh (MdMYB88, MdMYB23, and MdMYB124), and one each from A. hypogaea L. (AhMYB30), F. vesca (FvMYB82), S. lycopersicum L. (SiMYB15), G. max L. (GmMYBJ1), S. spontaneum (SsMYB18), C. intybus (CiMYB5), and StMYB66. The phylogenic and domain analyses suggest that StMYB66 is closely related to AtMYB88 and/or AtMYB124 of A. thaliana, supporting the hypothesis that StMYB66 is homologous to these genes. In M. domestica Borkh, the closest homologs to StMYB66 were MdMYB88 and MdMYB124, but not MdMYB23. Similarly, in S. lycopersicum L., homologous genes included SiMYB15 and MdMYB23. Other homologous genes, such as GmMYBJ1, SsMYB18, and CiMYB5 formed a separate cluster (Fig. 1B). These results collectively demonstrate that StMYB66 exhibits strong conservation with two homologs from A. thaliana (AtMYB88 and AtMYB124) and two from M. domestica (MdMYB88 and MdMYB124) while diverging significantly from homologs in other plant species such as G. max L., S. spontaneum, and C. intybus.

View Figure

• Download as Powerpoint
• Download Figure

Cloning and bioinformatic analyses of StMYB66.

The full-length StMYB66 gene (Soltu.DM.04G004510) was successfully cloned from S. tuberosum var. Atlantic. The gene spans 1413 bp and encoded 470 amino acids (Fig. 2A). The theoretical molecular weight of the StMYB66 protein is 53.3 kDa, with an isoelectric point of 6.71 mA (Fig. 2B). Analysis of the amino acid composition revealed that Ser (9.4%), Leu (8.9%), Lys (7.4%), and Thr (7.2%) were the predominant residues. The total number of negatively charged residues (Asp + Glu) was 59, while the positively charged residues (Arg + Lys) totaled 57. The aliphatic index of StMYB66 was calculated to be 77.79, and its instability index was 53.25, suggesting that the protein is moderately unstable. The Kyte–Doolittle hydropathy plot and overall average hydropathicity value of −0.527 indicates that StMYB66 is predominantly hydrophilic (Fig. 2B).

Using the SWISS-MODEL tool, we determined that the StMYB66 protein contains two conserved SANT DNA-binding domains, located at amino acid positions 53–103 and 106–154, respectively (Fig. 2C). The secondary structure, predicting using SOPMA, revealed that the composition of StMYB66 protein as follows: 42.34% α-helices, 4.89% β-turns, 11.49% extended strands, and 41.28% random coils (Fig. 2C). The tertiary structure prediction, also performed with SWISS-MODEL, identified a helix-turn-helix region, aligning with the predicted secondary structure features of StMYB66 (Fig. 2C). These findings provide comprehensive structural insights into the StMYB66 protein and highlight its potential role as a transcription factor with DNA-binding capabilities.

MADS-box factor binding motifs predominate in the StMYB66 promoter.

Analysis of the StMYB66 promoter revealed the presence of three distinct types of MADS (MCM1, AGAMOUS, DEFICIENS, Serum Response Factor)-box factor binding motifs: MA0001.1, MA0001.2, and MA0001.3. These motifs correspond to the MIKC, MIKC, and type II families, respectively, and are characterized by unique sequence features. The occurrences of these motifs within the StMYB66 promoter were 28, 17, and 27 sites, respectively (Table 1). This indicates that MADS-box motifs are the most abundant regulatory elements within the promoter region. The core sequence of the MADS-box motif, ccaaaattag, is rich in AT bases, which are known to be preferential bind site for MADS-box transcription factors (Fujisawa et al. 2011). The high AT content may facilitate specific interactions with these TFs. MADS-box transcription factors are crucial regulators of developmental processes, particularly in flower and fruit development. It is plausible that these factors bind to the identified motifs to modulate the expression of StMYB66 in a tissue-specific or developmental stage–specific manner. This suggests that the regulation of StMYB66 may be closely tied to key growth and reproductive processes in S. tuberosum.

Table 1. Motif information in the promoter of StMYB66.

View Fullscreen

Expression patterns of StMYB66.

Gene expression data for StMYB66 were obtained from the Spud DB database (http://spuddb.uga.edu/) and analyzed comprehensively. The results revealed that StMYB66 expression was highest in sprouting tubers and in whole plant grown in vitro. During tuber development, from young to mature stages, StMYB66 expression declined. Similar expression levels were observed across various tissues, including stamens, flowers, leaves, stems, stolons, petioles, and roots. When plants were subjected to water stress treatments, StMYB66 expression increased in leaves (Fig. 3A). Following infection with Phytophthora infestans, StMYB66 expression in resistant potato lines exhibited a delayed but significant increase. No expression was observed at early time points, but by 2 d postinfection, expression reached a level of 0.099. In susceptible lines, StMYB66 expression increased more dramatically, showing a 4-fold rise following infection (Fig. 3B). Low nitrogen treatments significantly enhanced StMYB66 expression across three potato varieties, demonstrating a strong response to nitrogen supplementation (Fig. 3C). However, long-term drought stress did not significantly alter StMYB66 expression in potato varieties (Fig. 3D). These findings suggest that StMYB66 expression is responsive to environment stresses, with specific patterns dependent on the type of stress. The gene appears to play a dynamic role in responding to water stress, pathogen infection, and nitrogen availability while remaining unaffected by prolonged drought conditions.

View Figure

• Download as Powerpoint
• Download Figure

StMYB66 is involved in the growth regulation of potato shoots and roots.

To investigate the role of StMYB66 in potato development, the vector pBWA(V)HS-StMYB66 was constructed, incorporating StMYB66 downstream of a 35S promoter (Fig. 4A). Successful insertion of the target gene was confirmed through Sanger sequencing. After selection on kanamycin sulfate, genetically transformed potato seedlings were screen by PCR, identifying 11 transgenic lines as positive based on the amplification of the target gene (Fig. 4B). Further confirmation of these lines was achieved by subculturing in a selection medium supplemented with 100 mg/L kanamycin. Positive transgenic lines demonstrated robust root systems after 2 weeks, while negative lines exhibited a dwarf phenotype with significantly fewer roots (Fig. 4C). Quantitative real-time PCR was used to assess StMYB66 expression levels in the transgenic lines, using EF1α as an internal reference. Results indicated considerable variability among the lines. Notably, line T01 exhibited the highest StMYB66 expression, ∼1000-fold higher than the wild-type control (Atlantic). Line T16 also displayed high pression level, with an increase of about 400-fold. Other lines (e.g., T02, T04, T05, T08, T13, T17, T18, T20, and T25) exhibited relatively lower expression levels comparable to the control Atlantic line (Fig. 5A).

View Figure

• Download as Powerpoint
• Download Figure

View Figure

• Download as Powerpoint
• Download Figure

Phenotypic analysis revealed that StMYB66 overexpression significantly affected plant growth. Lines OE-T01 and OE-T16 produced shorter plants with reduced height and increased root weight compared with the control after 4 weeks of growth (Fig. 5A). Further quantitative measurements showed that overexpression lines had significantly shorter plant height and heavier root fresh weight, while shoot fresh weight and root length remained similar to those of the control (Fig. 5B). These findings indicate that StMYB66 plays a role in regulating potato shoot and root growth. Its overexpression leads to reduced shoot height and enhanced root biomass, suggesting its involvement in developmental and physiology pathways crucial for root and shoot development in potato plants.

StMYB66 is involved in the regulation of anthocyanin synthesis.

Previous research has demonstrated a strong correlation between StMYB66 expression and anthocyamin accumulation. For instance, StMYB66 expressed levels were significantly higher in fresh red tubers compared with yellow tubers during all developmental stages, from tuber initiation (S1) to maturation (S3) (Fig. 6A) (Liu et al. 2023). Similarly, another study reported that StMYB66 expression was ∼2.5-fold higher in purple flesh than in white flesh ones (Fig. 6B) (Riveros-Loaiza et al. 2022). These observations suggest that StMYB66 may play a role in anthocyanin homeostasis. In this study, we observed that overexpression line OE-T01 exhibited a noticeable phenotypic change: the stems appeared purple after 2 months of subculturing, whereas the stems of the control remained green (Fig. 6C). This phenotypic variation suggests that StMYB66 influences anthocyanin biosynthesis in stems, potentially through pathways similar to those operating in tubers. These results collectively indicate that StMYB66 may regulate anthocyanin synthesis, particularly in tissues such as tubers and stems, and its activity likely contributes to pigmentation differences observed in potato cultivars.

View Figure

• Download as Powerpoint
• Download Figure

Transcriptome analysis between Atlantic and overexpression line OE-T01.

To uncover the dynamic regulatory pathways influenced by overexpression of StMYB66 in potato growth, we conducted RNA-sequencing analysis of leaves from Atlantic and OE-T01 line. The RNA-sequencing data were processed and aligned to the potato reference genome (DM8.1) (Yang et al. 2023) with match rates exceeding 94% on average (Q30; Supplemental Table 2). The mapped reads were used for subsequent analyses, with principal component analysis clearly separating the two genotypes into distinct cluster (Supplemental Fig. 1). This result indicates that the differential gene expression patterns observed were induced by StMYB66 overexpression. The genes with their expression level in different samples were shown in Supplemental Table 3. A comparison between Atlantic and OE-T01 identified a total of 1564 DEGs, with 664 genes especially expressed in OE-T01 and 900 Atlantic (Fig. 7A). Among these, 281 genes were upregulated and 287 were downregulated in OE-T01 (Fig. 7B, Supplemental Table 4).

View Figure

• Download as Powerpoint
• Download Figure

GO enrichment analysis revealed that most DEGs were associated with molecular function processes, such as oxidoreductase activity (GO:0016705), xyloglucan:xyloglucosyl transferase activity (GO:0016762), catalytic activity (GO:0003824), vitamin binding (GO:0019842), organic acid binding (GO:0043177), carboxylic acid binding (GO:0031406), glycosyltransferase activity (GO:0016757), xyloglucan metabolic process (GO:0010411), l-ascorbic acid binding (GO:0031418), glucosyltransferase activity (GO:0046527), and cell wall–related processes (Fig. 7C, Supplemental Table 5).

The gene DM8C01G44330 encoded a UDP-glycosyltransferase family with elevated expression in OE-T01 (Fig. 7D). DM8C02G16010 and DM8C02G33650, members of glycosyltransferase family 2, play central role in polysaccharide synthesis, a key component of plant cell wall. Notably, the homolog of DM8C02G16010 in Arabidopsis (AT4G18780) is involved in cell wall development by influencing cellulose crystallization (Glass et al. 2015). Similarly, DM8C02G20070, encoding pectinesterase, modified the cell wall via pectin demethylesterification. Its homolog, AT1G11890, regulated cell morphogenesis in Arabidopsis (Guan et al. 2021). DM8C03G02430 encoded a class III peroxidase, a cell wall–localized protein that modulates wall loosening and stiffening by producing reactive oxygen species and oxidizing aromatic compounds linked to polysaccharides. Additionally, DM8C03G15570, DM8C03G15580, DM8C03G15590, DM8C07G18690, and DM8C02G27260 encoded xyloglucan:xyloglucosyl transferase, which exhibited significantly lower expression in OE-T01 compared with Atlantic (Fig. 7D). These enzymes, categorized under glycoside hydrolase family 16, are crucial for cell wall remodeling and expansion (Stratilová et al. 2020). For instance, the Arabidopsis homolog of DM8C03G15580 (AT4G25810) is involved in lateral root emergence via the auxin pathway. Furthermore, DM8C03G02920 encoded expansin A13, which may mediate pH-dependent cell wall loosening (Supplemental Table 6).

The plant hormone ethylene also plays a role in the StMYB66 growth regulation pathway. Notably, DM8C01G31600, encoding 1-aminocyclopropane-1-carboxylate synthase, a key enzyme in ethylene biosynthesis, was differentially expressed between Atlantic and OE-T01. Nitrogen metabolism is another pathway influenced by StMYB66. The DEG DM8C01G14390 encoded glutamine synthetase, a key enzyme for ammonium assimilation and metabolism. It catalyzed the ATP-dependent addition of ammonium (NH⁴⁺) to glutamate to form glutamine, a central component of nitrogen flow in plants. The Arabidopsis homolog AT3G53180 regulates root morphogenesis through nitrogen assimilation pathway (Doskočilová et al. 2011). This suggests that the nitrogen-dependent expression of MYB66 may influence DM8C01G14390 expression, contributing to growth regulation (Fig. 3C). Micronutrients also appear to be involved in StMYB66-mediated growth regulation. Gene such as DM8C01G02260, DM8C02G15120, DM8C02G15140, DM8C01G02200, and DM8C01G07730 encoded iron ascorbate–dependent oxidoreductase. Homologous genes in Arabidopsis regulated iron reduction, which is crucial for primary root growth under phosphate-deficient conditions (Clúa et al. 2024).