Images of the five-leaf stage of male Zizania latifolia seedlings: (A) seedlings and (B) enlarged view of partial longitudinal cutting.
Changes in the activities of antioxidant-related enzymes ascorbate peroxidase (APX), catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and malondialdehyde (MDA) content following infection of male Zizania latifolia by Ustilago esculenta. Error bars represent standard deviations of mean values from three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Changes in the activities of enzymes related to the phenylpropanoid metabolism pathway, namely polyphenol oxidase (PPO) and phenylalanine ammonia-lyase (PAL), after infection of Zizania latifolia by Ustilago esculenta. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Changes in chitinase and β-1,3-glucanase activities in Zizania latifolia following infection by Ustilago esculenta. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Patterns of relative gene expression analysis of ZlChi genes in Zizania latifolia leaves revealed by real-time fluorescence quantitative polymerase chain reaction in response to Ustilago esculenta infection. ZlActin2 served as an internal control to normalize data. The y-axes, indicating relative expression levels, are drawn to different scales depending on the magnitude and direction of change. Upregulated expression is represented by whole-number y-axis values, whereas downregulated gene expression is indicated by decimal fractions on the y-axis scale. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Electrophoretic image (2.0% agarose gel) of real-time quantitative polymerase chain reaction products of Ue-Actin from roots of male Zizania latifolia 15 d after inoculation with Ustilago esculenta; M = DNA markers; lanes 1–15 = extracts of male Z. latifolia plants inoculated with U. esculenta; lane 16 = negative control; lane 17 = positive control.
Paraffin sections of roots from male Zizania latifolia 15 d after inoculation with Ustilago esculenta [10× field of view, fluorescein isothiocyanate-conjugated wheat germ agglutinin staining; green fluorescence represents fungal hyphae and red fluorescence is the cell wall of root tissue]. (A) Paraffin section of roots of male Z. latifolia plants inoculated with potato dextrose liquid medium (CK = control). (B) Paraffin section of roots of male Z. latifolia plants inoculated with U. esculenta.
Electrophoretic image (2.0% agarose gel) of polymerase chain reaction amplification of ZlActin (primer sequences listed in Supplemental Table 1) from treated and control samples of Zizania latifolia. M = DNA markers. (A) Male Z. latifolia inoculated with potato dextrose liquid medium; (B) male Z. latifolia plants inoculated with U. esculenta; lanes 1 − 7 = 3, 6, 12, 18, and 24 h, and 3 and 5 d after treatment.
Click on author name to view affiliation information
This study explored the effects of Ustilago esculenta inoculation on physiological responses (activities of defense and antioxidant enzymes) and chitinase gene expression in male Zizania latifolia “jiaobai” (without U. esculenta infection, with no galls, but normal flowering). Male jiaobai seedlings were injected at the five-leaf stage with U. esculenta suspension, and the impact on transcription of several genes encoding enzymes was examined. Compared with controls, expression of most enzymes was significantly different at 3 or 12 hours postinjection, and most ZlChi genes were involved in the response to U. esculenta inoculation. Fluorescence quantitative polymerase chain reaction results showed that U. esculenta was present in the roots of male jiaobai inoculated with U. esculenta at the shoot tips. Paraffin sections revealed many fungal hyphae in the roots at 15 d after inoculation, but few in controls. The results provide a basis for further study of the responses of male Z. latifolia to U. esculenta infection.
Zizania latifolia, also known as Manchurian wild rice, is an asexual perennial herb and the second most widely cultivated aquatic vegetable in China (Yu et al. 2020). The endophytic smut fungus Ustilago esculenta induces the formation of culm galls (jiaobai) in Z. latifolia. Normal jiaobai (edible swollen galls in stem bases filled with hyphae), gray jiaobai (inedible galls filled with dark teliospores, with an unacceptable taste), and male jiaobai (without U. esculenta infection, with no galls but normal flowering) are the three phenotypes of Z. latifolia found in their habitats (Wang et al. 2020). At present, the method of isolation and selection of Z. latifolia used in cultivation and conservation breeding requires considerable labor and material resources. Moreover, population diversity and physiological race differentiation of U. esculenta may exist among Z. latifolia populations (Tu et al. 2019). The molecular mechanisms of Z. latifolia responses to U. esculenta infection are not completely understood, although the mechanism of swelling and stem enlargement in infected Z. latifolia has received attention (Li et al. 2022; Zhang et al. 2021).
Research on the physiological and biochemical aspects of Ustilago-induced stem expansion of Z. latifolia has focused mainly on changes in antioxidant enzymes, including peroxidase (POD), superoxide dismutase (SOD), catalase (CAT), and polyphenol oxidase (PPO). The activities of SOD, CAT, and PPO decrease during the process of stem expansion, whereas POD activity increases during the middle stage of stem expansion, suggesting that POD might participate in the differentiation and expansion of Zizania cells and tissues (Jiang et al. 2007). Meanwhile, proteomic studies have explored the stem expansion process of Z. latifolia. The number and expression level of unique proteins in stems of Z. latifolia at different developmental stages varies significantly, and the formation of fleshy stem bases of Z. latifolia result from interactions between plants and endophytic fungi (Liu et al. 2011). During the process of fleshy stem expansion, 4389 upregulated and 3700 downregulated genes were detected in normal Z. latifolia. By comparison, in gray Z. latifolia, 3121 genes were upregulated and 2130 genes were downregulated (Wang et al. 2017). Jose et al. (2019) detected qualitatively and quantitatively differentially expressed proteins in response to local U. esculenta formation during the interaction between Z. latifolia and U. esculenta and found that U. esculenta produced proteases and energy acquisition proteins that enhanced its defense and survival in the host.
Plants can be invaded by various pathogens. To cope with pathogen infection, a series of physiological and biochemical changes take place in challenged plants. Among these, changes in key enzyme activities related to plant disease resistance can effectively enable plants to withstand further infection by pathogens (Espinosa-Vellarino et al. 2020; Waszczak et al. 2018). These defense enzymes can improve the tolerance and resistance of plants to external abiotic and biotic stresses (Zhang 2020). Pathogenesis-related proteins (PRs), such as chitinases and β-1,3-glucanase, are a class of proteins induced by biotic or other external factors that play an important role in plant disease resistance (Tuan et al. 2019; Zhou et al. 2020). In the absence of pathogens, chitinase and β-1,3-glucanase activities in plants are very low, but when plants are infected by fungal phytopathogens, the activities of β-1,3-glucanase and chitinase increase within a short time, rapidly degrading chitin in the cell walls of phytopathogenic fungi and inhibiting the growth and reproduction of pathogenic fungi in resistant plants, thereby increasing the resistance of plants to pathogens (Bai et al. 2018; Hu et al. 2017; Khan et al. 2017).
In previous studies on interactions between Z. latifolia and U. esculenta, we established an in vitro Z. latifolia regeneration system, explored the U. esculenta inoculation system (Yang 2018), and studied the expression of Z. latifolia chitinase in response to abiotic stress (Zhou et al. 2020). However, the mechanism underpinning the interaction between U. esculenta and Z. latifolia that leads to enlargement of swollen stem galls remains unclear. To explore the physiological basis and molecular mechanisms of the Z. latifolia responses to U. esculenta infection, male (uninfected) Z. latifolia plants at the five-leaf stage were used as the experimental material to explore the effects of artificial inoculation on the responses of disease resistance-associated enzymes, phenylpropanoid metabolism-related enzymes and antioxidant enzymes, as well as the responses of membrane lipid peroxidation. In addition, paraffin sections of roots and stems of Z. latifolia plants at 15 d after U. esculenta inoculation were collected to probe changes in U. esculenta fungus development. This work provides an important basis for future studies on the mechanism of culm gall formation in Z. latifolia.
Single colonies (mycelium) of U. esculenta were selected and cultured in potato dextrose liquid medium at 28 °C with shaking at 220 rpm on an orbital shaker. When the optical density at 600 nm (OD600) reached 0.6 to 0.8, cultures were expanded at a dilution of 1:50 overnight. The suspension was then centrifuged at 2632 gn for 20 min to collect cells, and the pellet was resuspended in potato dextrose liquid medium and diluted to OD600 = 2.5 (Geng 2018; Yang 2018).
Male jiaobai plants at the five-leaf stage (Fig. 1A) were injected at the stem tip growth point with the resulting U. esculenta cell suspension, 0.5 cm from the base of the bolting tube (Fig. 1B, red arrow). Male jiaobai plants injected with potato dextrose liquid medium served as controls (CK). Experiments were repeated three times with six plants per replicate.
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
Crude extracts of leaves of Z. latifolia plants were prepared at 3, 6, 12, 18, and 24 h after inoculation, and the activities of defense enzymes and antioxidant enzymes were assayed. The activities of ascorbate peroxidase (APX) and phenylalanine ammonia lyase (PAL) were determined according to the methods of Gao and Cai (2018); the activity of POD was assayed according to the method of Wu (2018); the activities of SOD and CAT were determined according to the methods of Gao and Cai (2018); the activity of PPO was determined using the methodology described by Dalmadi et al. (2006). Extraction of chitinase and β-1,3-glucanase was performed according to the methods of Liu (2013) and Boller et al. (1983), respectively. The activity of β-1,3-glucanase was determined using the method of Jiang et al. (2015), and a glucose standard curve was prepared according to the method of Li (1998). Determination of chitinase activity and preparation of an N-acetylglucosamine standard curve were conducted according to the methods of Liu (2013) and Zhang et al. (2013), respectively. Three biological replicates were performed for each treatment, with six plants per replicate.
Leaves at 3, 6, 12, 18, and 24 h, and 3 and 5 d after inoculation, were ground with liquid nitrogen, total RNA was extracted using TRIzol reagent (RNAiso Plus; Takara, Dalian City, China), and treated using a PrimeScript RT Reagent Kit and gDNA Eraser (Takara) to remove genomic DNA contamination. The quality and purity of samples were monitored using a spectrophotometer (NanoDrop 2000C; Thermo Fisher Scientific, Waltham, MA, USA). Total RNA (1 μg) was reverse-transcribed to first-strand cDNA using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the manufacturer’s instructions. The resulting cDNA was diluted 10-fold with sterile water. Gene-specific primers (Supplemental Table 1) used for quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis of the Z. latifolia chitinase gene were designed using Primer Premier 5.0 software (Kakhki et al. 2019). The expression level of the Z. latifolia Actin2 gene (primer sequences listed in Supplemental Table 1) (Wang et al. 2017), which is consistent in different organs and under different treatments, was used as an internal control (Supplemental Fig. 1). qRT-PCR was carried out according to the instructions of the PrimeScript RT Reagent Kit with gDNA Eraser (Takara). Three biological replicates were performed for each treatment, and each cDNA sample was tested using four technical replicates. Relative expression levels were calculated as 2−ΔΔCq where ΔCq = Cq (gene of interest) – Cq (Actin2), ΔΔCq = ΔCq (treatment, inoculated with U. esculenta) − ΔCq (CK, inoculated with potato dextrose broth).
Genomic DNA was extracted from roots of plants at 15 d after inoculation, and expression of the actin gene of U. esculenta was measured by qRT-PCR (Ge et al. 2021). Male jiaobai plants inoculated with potato dextrose liquid medium served as a negative control, and U. esculenta DNA served as a positive control. Primers P1 (CAATGGTTCGGGAATGTGC) and P2 (GGGATACTTGAGCGTGAGGA) were used to amplify the actin gene sequence (KU302684.1). qRT-PCR was performed according to the preceding instructions, and products were detected by electrophoresis on a 2.0% agarose gel and purified. The obtained target fragments were ligated into the pMD19-T vector, transformed, and sequenced (Sangon Biotech Shanghai Co. Ltd., Shanghai, China).
At 15 d after inoculation, roots of male Z. latifolia were quickly fixed in formaldehyde-acetic acid-ethanol fixative comprising 5% formalin (37% to 40% formaldehyde) + 5% glacial acetic acid + 90% alcohol (70%). Using qRT-PCR detection, roots that only amplified the Ue-actin gene of U. esculenta and roots without any amplified band were analyzed by paraffin section, including tissue cleaning, fluorescent staining of fungal cell walls with fluorescein isothiocyanate-conjugated wheat germ agglutinin (FITC-WGA), and counterstaining of plant cell walls with propidium iodide (Redkar et al. 2018), performed by Wuhan Seville Biotechnology Co., Ltd. (Wuhan, China).
Spreadsheet software (Microsoft Excel 2016; Microsoft Corp., Redmond, WA, USA) was used for basic processing of test data, statistical analysis software (IBM SPSS statistics ver. 25; IBM Corp., Armonk, NY, USA) was used for analysis of variance (P ≤ 0.05 indicates statistical significance), and data analysis/scientific graphing software (SigmaPlot 14.0, Systat International Software, San Jose, CA, USA); Origin 2019b 32-bit (OriginLab, Northampton, MA, USA) were used for mapping.
APX activity in leaves of male Z. latifolia inoculated with U. esculenta was significantly higher than in control plants at 12 h after inoculation, indicating that 12 h was a suitable timepoint for assessing APX involvement in the response to U. esculenta injection (Fig. 2). CAT activity in the treated group was also higher than that in the control group, with the highest level of 73.67 U/g fresh weight per minute occurring at 3 h after inoculation, and the difference was significant (P ≤ 0.05; Fig. 2). The same trend was observed for POD activity, indicating that the response of POD activity to U. esculenta mainly occurred shortly after inoculation (Fig. 2). There was no significant difference in SOD activity and malondialdehyde (MDA) content between treated and control plants within 24 h after inoculation (Fig. 2).
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
PPO activity of the treated group was significantly lower than that of the control at 6 h after inoculation (P ≤ 0.05), whereas PAL activity in the treated group was insignificant compared with that of the control group (P ≤ 0.05; Fig. 3). Chitinase in leaves of male Z. latifolia showed a pattern of decreasing activity over time, and there was a significant difference between treated and control groups only at 12 h after inoculation (P ≤ 0.05; Fig. 4). The activity of β-1,3-glucanase in the treated group was higher than that of the control group at 3, 6, and 18 h after inoculation, with a significant difference at 3 h after inoculation (P ≤ 0.05; Fig. 4).
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
Expression of individual ZlChi genes was detected at 3, 6, 12, 18, and 24 h, and 3 and 5 d after treatment. The expression patterns of ZlChi genes were different, among which expression of three ZlChi genes (ZlChi2, ZlChi5, and ZlChi9) could not be detected, whereas that of the other eight responded to U. esculenta inoculation (Fig. 5). ZlChi1 expression was upregulated, and the difference was significant (P ≤ 0.05) at 18 h and 3 d after inoculation. Expression of ZlChi6 was upregulated at 3, 6, and 12 h after inoculation, and the difference was significant (P ≤ 0.05). The relative expression level of ZlChi8 was highest at 5 d after inoculation, and the difference was significant (P ≤ 0.05), whereas the relative expression level of ZlChi10 was also upregulated at 3, 6, and 18 h after inoculation. The relative expression level of ZlChi11 reached a peak (10.50) at 3 h after injection, but expression of the other ZlChi genes was low or downregulated in response to U. esculenta inoculation (Fig. 5).
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
The root DNA templates at 15 d after inoculation were amplified using primers targeting Ue-Actin. Agarose gel electrophoresis showed that only one band was detected in some roots of male jiaobai plants inoculated with U. esculenta, and sequencing results showed that the fragment was 243 bp in size, with 100% homology to Ue-Actin (KU302684.1). In addition, two bands of 243 bp (Ue-Actint) and 139 bp (86% identical to the NIH2624 actin gene XM_001209659.1 of Aspergillus terreus) were detected in other inoculated roots. Meanwhile, some roots were not infected at all by any fungi, and some were only infected with one fungal species (Fig. 6). This indicated that some Z. latifolia plants had been successfully infected by U. esculenta 15 d after inoculation.
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
Roots that only amplified bands (243 bp) of U. esculenta at 15 d after inoculation and control roots were selected for paraffin sectioning. The root tissue of male Z. latifolia plants was quickly fixed in formaldehyde-acetic acid-ethanol (FAA) fixative, and paraffin sections were stained with FITC-WGA and counter-stained with propidium iodide. In the same field of vision (10× field of view), numerous fungal hyphae could be observed in the roots of male Z. latifolia plants inoculated with U. esculenta, whereas few fungal hyphae of A. terreus could be seen in the roots of control male Z. latifolia plants (Fig. 7). This indicated that U. esculenta had successfully infected male Z. latifolia plants.
Citation: Journal of the American Society for Horticultural Science 148, 2; 10.21273/JASHS05277-22
When plants encounter stress, it can regulate various antioxidant enzymes (e.g., APX, POD, SOD, and CAT) and disease resistance-related enzymes (chitinase and β-1,3-glucanase) to reduce damage to cells and tissues (Tyagi et al. 2020; Wang et al. 2021a). Key enzymes of the phenylpropane metabolic pathway (e.g., PAL and PPO) can also respond quickly to invasion of plant pathogens (Sakhuja et al. 2021; Syed et al. 2021). Yan et al. (2013) reported that U. esculenta infection led to an increase in APX, CAT, POD, glutathione reductase, and SOD activities in Z. latifolia leaves, and a decrease in the concentrations of superoxide free radicals and MDA. Our results showed that inoculation of Z. latifolia with U. esculenta significantly increased the activities of APX and CAT enzymes in leaves. The activities of CAT and POD were highest at 3 h after inoculation, whereas SOD activity was highest at 18 h after inoculation. Changes in antioxidant enzyme activity were consistent with previous reports by Yan et al. (2013).
Chitinase (EC 3.2.1.14) is a type of glycosidase that degrades chitin from fungi and responds to fungal infection (Zhou et al. 2020). β-1,3-glucanase (EC 3.2.1.39) inhibits the growth of fungi by catalyzing the hydrolysis of β-1,3-glucan in fungal cell walls, participates in the defense of plants against pathogenic fungi (Ali et al. 2021). When crops are infected by phytopathogenic fungi, chitinase and β-1,3-glucanase can inhibit the growth of pathogenic fungi, thus mediating resistance to fungal pathogens (Toufiq et al. 2018). Our results showed that chitinase activity in male Z. latifolia leaves was higher than in controls, and the gradual decrease in activities of chitinase and β-1,3-glucanase was similar to that reported by Wang et al. (2021b).
PPO (EC 1.10.3.1) is associated with disease resistance, pest resistance, and stress tolerance (Kanjanapongkul and Baibua 2021; Zhao et al. 2021), and PAL (EC 4.3.1.24) regulates the biosynthesis of secondary metabolites associated with plant disease resistance (Dong and Lin 2021). In the current study, PPO activity in treated plants was significantly lower than that in controls at 6 h post-injection. PAL activity in treated plants was also higher than that in controls. These results revealed that the increases in PPO and PAL activities in treated plants mainly occurred in the early stages of the colonization process. Previous research also showed that PAL activity was higher during the early stages of U. esculenta colonization in Z. latifolia (Cheng 2002). However, in the present study, PAL activity reached the highest level at 12 h after inoculation. Thus, infection by U. esculenta altered antioxidant enzyme activity in Z. latifolia plants. Endophytic fungi and their hosts need to adapt and evolve together over a long period of time to form a mutually beneficial symbiotic relationship (Delavaux et al. 2019; Saikkonen et al. 2004). The observed changes in the activities of enzymes in Z. latifolia plants may be related to the formation of a mutually beneficial symbiosis between Z. latifolia and U. esculenta. However, infection of male jiaobai plants by U. esculenta and the resulting symbiotic relationship require further investigation.
Plant chitinases are pathogenesis-related proteins that degrade chitin, damage the fungal cytoskeleton, inhibit the growth of pathogenic fungi, and elicit antifungal effects (Bartholomew et al. 2019; Chen et al. 2018). Previous research showed that chitinase genes regulate the responses of Morus laevigata to Sclerotinia sclerotiorum infection (Jiang et al. 2020). Similarly, upregulated expression of GH19 (TEA028279 and TEA019397) indicated that chitinase genes play defensive roles in responses to fungal infection (Bordoloi et al. 2021). The current study showed that, apart from ZlChi2, ZlChi5, and ZlChi9 genes, expression of the other eight ZlChi genes responded to U. esculenta infection. Thus, we speculated that these genes may be involved in the infection process of male Z. latifolia by U. esculenta. Previous research revealed time differences in the expression patterns of different CmCHT genes in Cucumis melo induced by pathogen infection (Wang et al. 2021b). Similarly, in the present study, expression of most ZlChis also showed temporal differences. Expression of most chitinase genes peaked during the early stages after inoculation, indicating an involvement in the colonization of U. esculenta. However, expression of ZlChi1, ZlChi4, and ZlChi8 peaked at 3 or 5 d after inoculation, indicating that these genes might play a key role in the later stages of U. esculenta infection.
In the current study, fluorescence quantitative PCR was used to detect fungal genomic DNA in male Z. latifolia roots at 15 d after inoculation, and the results showed that only the Ue-Actin gene, or two fragments (the Ue-Actin gene fragment and the NIH2624 actin gene fragment), were amplified from the roots of some inoculated plants, indicating that U. esculenta successfully infected and reached the roots of male jiaobai plants at 15 d after inoculation. Meanwhile, the NIH2624 actin gene fragment was amplified from other treated plants, which indicates that there were other fungi (A. terreus) within male Z. latifolia plants.
Li (2016) found that U. esculenta in normal Z. latifolia (with swollen stem bases) was mainly distributed in the root and stem in the form of hyphae, with the number of hyphae in the stem being closely related to the supply of nutrients to the stem. Zhou (2018) found that mycelium of U. esculenta were present in the stem of normal Z. latifolia at the five-leaf stage, with the growth and distribution of U. esculenta in the stem of normal Z. latifolia being closely related to the growth and development state of the plant. In the present study, paraffin sections revealed multiple fungal hyphae in the roots of inoculated plants, although only a small number of fungal hyphae were detected in the roots of control plants, indicating that there might be other fungi within Z. latifolia plants. The existence of microbial diversity in Z. latifolia is consistent with the results of Zhan (2017). Similarly, Tu et al. (2019) isolated several strains of U. esculenta as well as six other species of fungi and 10 species of bacteria from five samples of galls harvested at different stages of swelling. In the present study, U. esculenta was detected in the roots of some inoculated plants, indicating that U. esculenta had successfully colonized male Z. latifolia plants. However, a small number of other fungi were also detected in roots, which suggests that there might be a variety of fungi in Z. latifolia plants. Whether these fungal hyphae in inoculated plants can cause expansion into fleshy stem galls needs to be investigated in future studies.
We injected male jiaobai plants at the five-leaf stage with U. esculenta suspension and examined the activities of related enzymes. Compared with controls, the activities of most enzymes were significantly different at 3 or 12 h after infection. Most ZlChis were involved in the response to U. esculenta inoculation. Fluorescence quantitative PCR results showed that U. esculenta was present in the roots of male jiaobai, and paraffin sections revealed many fungal hyphae in roots at 15 d after inoculation. These results provide a basis for further studies on the interactions between U. esculenta and Z. latifolia, and the stem expansion mechanism of Z. latifolia.
Images of the five-leaf stage of male Zizania latifolia seedlings: (A) seedlings and (B) enlarged view of partial longitudinal cutting.
Changes in the activities of antioxidant-related enzymes ascorbate peroxidase (APX), catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and malondialdehyde (MDA) content following infection of male Zizania latifolia by Ustilago esculenta. Error bars represent standard deviations of mean values from three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Changes in the activities of enzymes related to the phenylpropanoid metabolism pathway, namely polyphenol oxidase (PPO) and phenylalanine ammonia-lyase (PAL), after infection of Zizania latifolia by Ustilago esculenta. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Changes in chitinase and β-1,3-glucanase activities in Zizania latifolia following infection by Ustilago esculenta. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Patterns of relative gene expression analysis of ZlChi genes in Zizania latifolia leaves revealed by real-time fluorescence quantitative polymerase chain reaction in response to Ustilago esculenta infection. ZlActin2 served as an internal control to normalize data. The y-axes, indicating relative expression levels, are drawn to different scales depending on the magnitude and direction of change. Upregulated expression is represented by whole-number y-axis values, whereas downregulated gene expression is indicated by decimal fractions on the y-axis scale. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Electrophoretic image (2.0% agarose gel) of real-time quantitative polymerase chain reaction products of Ue-Actin from roots of male Zizania latifolia 15 d after inoculation with Ustilago esculenta; M = DNA markers; lanes 1–15 = extracts of male Z. latifolia plants inoculated with U. esculenta; lane 16 = negative control; lane 17 = positive control.
Paraffin sections of roots from male Zizania latifolia 15 d after inoculation with Ustilago esculenta [10× field of view, fluorescein isothiocyanate-conjugated wheat germ agglutinin staining; green fluorescence represents fungal hyphae and red fluorescence is the cell wall of root tissue]. (A) Paraffin section of roots of male Z. latifolia plants inoculated with potato dextrose liquid medium (CK = control). (B) Paraffin section of roots of male Z. latifolia plants inoculated with U. esculenta.
Electrophoretic image (2.0% agarose gel) of polymerase chain reaction amplification of ZlActin (primer sequences listed in Supplemental Table 1) from treated and control samples of Zizania latifolia. M = DNA markers. (A) Male Z. latifolia inoculated with potato dextrose liquid medium; (B) male Z. latifolia plants inoculated with U. esculenta; lanes 1 − 7 = 3, 6, 12, 18, and 24 h, and 3 and 5 d after treatment.
Contributor Notes
This research was supported by grants from the Natural Science Foundation of Anhui Province (grant number 2008085MC80) and the Anhui Province Crop Variety Breeding Project. We thank Elixigen Corporation for editing this manuscript.
W.X. and N.N.Z. contributed equally to this work.
D.G. is the corresponding author. E-mail: dfgan1@163.com.
Images of the five-leaf stage of male Zizania latifolia seedlings: (A) seedlings and (B) enlarged view of partial longitudinal cutting.
Changes in the activities of antioxidant-related enzymes ascorbate peroxidase (APX), catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and malondialdehyde (MDA) content following infection of male Zizania latifolia by Ustilago esculenta. Error bars represent standard deviations of mean values from three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Changes in the activities of enzymes related to the phenylpropanoid metabolism pathway, namely polyphenol oxidase (PPO) and phenylalanine ammonia-lyase (PAL), after infection of Zizania latifolia by Ustilago esculenta. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Changes in chitinase and β-1,3-glucanase activities in Zizania latifolia following infection by Ustilago esculenta. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Patterns of relative gene expression analysis of ZlChi genes in Zizania latifolia leaves revealed by real-time fluorescence quantitative polymerase chain reaction in response to Ustilago esculenta infection. ZlActin2 served as an internal control to normalize data. The y-axes, indicating relative expression levels, are drawn to different scales depending on the magnitude and direction of change. Upregulated expression is represented by whole-number y-axis values, whereas downregulated gene expression is indicated by decimal fractions on the y-axis scale. Error bars represent standard deviations of the mean values of three biological replicates. Shared lowercase letters indicate no significant differences in activities of a particular enzyme between different treatments via analysis of variance (P ≤ 0.05).
Electrophoretic image (2.0% agarose gel) of real-time quantitative polymerase chain reaction products of Ue-Actin from roots of male Zizania latifolia 15 d after inoculation with Ustilago esculenta; M = DNA markers; lanes 1–15 = extracts of male Z. latifolia plants inoculated with U. esculenta; lane 16 = negative control; lane 17 = positive control.
Paraffin sections of roots from male Zizania latifolia 15 d after inoculation with Ustilago esculenta [10× field of view, fluorescein isothiocyanate-conjugated wheat germ agglutinin staining; green fluorescence represents fungal hyphae and red fluorescence is the cell wall of root tissue]. (A) Paraffin section of roots of male Z. latifolia plants inoculated with potato dextrose liquid medium (CK = control). (B) Paraffin section of roots of male Z. latifolia plants inoculated with U. esculenta.
Electrophoretic image (2.0% agarose gel) of polymerase chain reaction amplification of ZlActin (primer sequences listed in Supplemental Table 1) from treated and control samples of Zizania latifolia. M = DNA markers. (A) Male Z. latifolia inoculated with potato dextrose liquid medium; (B) male Z. latifolia plants inoculated with U. esculenta; lanes 1 − 7 = 3, 6, 12, 18, and 24 h, and 3 and 5 d after treatment.
