Search Results

You are looking at 81 - 90 of 91 items for :

  • "polyacrylamide gel electrophoresis" x
  • All content x
Clear All
Free access

Hetal M. Kalariya, Guido Schnabel, Cesar Petri, and Ralph Scorza

μg) was used to perform sodium dodecyl sulfate–polyacrylamide gel electrophoresis using 15% Tris-HCl ready Gels (Bio-Rad Laboratories, Hercules, CA). Protein was transferred to an immunoblot polyvinylidene fluoride membrane (Bio-Rad Laboratories), and

Free access

Patrick Burgess and Bingru Huang

by means of two-dimensional polyacrylamide gel electrophoresis separation and mass spectrometry (MS) identification has effectively described changes in proteomic abundance within various tissues of different plant species responding to abiotic

Free access

Yali He and Bingru Huang

. Electrophoresis for isozyme assays. Samples were subjected to discontinuous polyacrylamide gel electrophoresis under nondenaturing, nonreducing conditions as described by Laemmli (1970) with some modifications. SOD was detected on 10.8% acrylamide gels, and

Free access

Sasmita Mishra, Scott Heckathorn, Jonathan Frantz, Futong Yu, and John Gray

by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), using 12% acrylamide, 16 × 20-cm gels (50 μg of total protein per lane) (e.g., Heckathorn et al., 2002 ). Following electrophoresis, gels were stained for total proteins using

Free access

Xunzhong Zhang, Erik H. Ervin, Yiming Liu, Guofu Hu, Chao Shang, Takeshi Fukao, and Jasper Alpuerto

antioxidant enzymes. The extracts (15 µL) for SOD, CAT, and APX were loaded on each gel. Native polyacrylamide gel electrophoresis (PAGE) was performed using a Mini-Protean system (Bio-Rad Laboratories, Hercules, CA) at 4 °C, 120 V for 90 min, except that SDS

Free access

Zhuang-Zhuang Liu, Tao Chen, Fang-Ren Peng, You-Wang Liang, Peng-Peng Tan, Zheng-Hai Mo, Fan Cao, Yang-Juan Shang, Rui Zhang, and Yong-Rong Li

poor safety, low efficiency, and low resolution of the MSAP technique involving polyacrylamide gel electrophoresis, Xu et al. (2005) introduced a fluorescence labeling system with capillary electrophoresis for MSAP, named F-MSAP, which is safe for

Free access

Li-Juan Zhang, Tian-Xiu Zhong, Li-Xin Xu, Lie-bao Han, and Xunzhong Zhang

separated on nondenaturating native polyacrylamide gel electrophoresis. The procedure for protein extraction was the same as for TSP, and the protein was extracted from 0.2 g frozen leaves with 1 mL extraction buffer. Native PAGE was conducted using a mini

Free access

Jing Tian, Li-Ping Wang, Yan-Juan Yang, Jin Sun, and Shi-Rong Guo

,000 g n for 20 min at 4 °C, and the supernatant was centrifuged again. For the extraction of APX, 10 m m AsA and 1 m m EDTA were added. Native polyacrylamide gel electrophoresis (PAGE), using 3% concentrated gel and 8% separating gel, was performed at

Free access

Xiaohe Song and Zhanao Deng

genomic DNA from each progeny of the respective bulks was combined. The two DNA bulks and the genomic DNA of UFGE 4033 and ‘Sunburst Snow White’ were run simultaneously in polymerase chain reaction (PCR) amplification and polyacrylamide gel electrophoresis

Full access

Qianqian Shi, Xiaoxiao Zhang, Xiang Li, Lijuan Zhai, Xiaoning Luo, Jianrang Luo, Lixia He, Yanlong Zhang, and Long Li

, CA) at Biomarker Technologies (Beijing, China). First, sRNAs (18–30 nt) were isolated from the total RNA by 15% TBE–urea denaturing polyacrylamide gels electrophoresis, and a 5′ RNA adaptor (GTTCAGAGTTCTACAGTCCGACGATC) and 3′ RNA adaptor