Search Results

You are looking at 81 - 90 of 94 items for :

  • "polyacrylamide gel electrophoresis" x
  • Refine by Access: All x
Clear All
Free access

Matthew A. Escobar, Andrew Shilling, Pine Higgins, Sandra L. Uratsu, and Abhaya M. Dandekar

tissue, but activity was absent within the shell in pellicle and kernel tissues. As a complement to spectrophotometric PPO activity assays, protein extracts were separated using native polyacrylamide gel electrophoresis and subjected to an in-gel PPO

Free access

Choun-Sea Lin, Nien-Tzu Liu, De-Chih Liao, Jau-Song Yu, Chuang-Hwei Tsao, Chao-Hsiung Lin, Chih-Wen Sun, Wann-Neng Jane, Hsing Sheng Tsay, Jeremy Jian-Wei Chen, Erh-Min Lai, Na-Sheng Lin, Wei-Chin Chang, and Chung-Chih Lin

gel electrophoresis (SDS-PAGE) system (Mini-P III; Bio-Rad), and covered by 1% agarose containing bromphenol blue. The SDS-PAGE was performed at 100 V for 120 min, following which the gel was stained by Coomassie blue. The experiments were repeated

Free access

Xunzhong Zhang, Kehua Wang, and Erik H. Ervin

mixed with 100 μL of 2 × SDS buffer [0.125 mol·L −1 Tris/HCl, pH 6.8, 20% (v/v) glycerol, 0.01% (v/v) bromphenol blue, 200 m m dithiothreitol, and 4% (w/v) SDS] was used for Sodium dodeclysulfate polyacrylamide gel electrophoresis analysis ( Laemmli

Free access

Li-Juan Zhang, Tian-Xiu Zhong, Li-Xin Xu, Lie-bao Han, and Xunzhong Zhang

separated on nondenaturating native polyacrylamide gel electrophoresis. The procedure for protein extraction was the same as for TSP, and the protein was extracted from 0.2 g frozen leaves with 1 mL extraction buffer. Native PAGE was conducted using a mini

Free access

Xunzhong Zhang, Erik H. Ervin, Yiming Liu, Guofu Hu, Chao Shang, Takeshi Fukao, and Jasper Alpuerto

antioxidant enzymes. The extracts (15 µL) for SOD, CAT, and APX were loaded on each gel. Native polyacrylamide gel electrophoresis (PAGE) was performed using a Mini-Protean system (Bio-Rad Laboratories, Hercules, CA) at 4 °C, 120 V for 90 min, except that SDS

Free access

Zhuang-Zhuang Liu, Tao Chen, Fang-Ren Peng, You-Wang Liang, Peng-Peng Tan, Zheng-Hai Mo, Fan Cao, Yang-Juan Shang, Rui Zhang, and Yong-Rong Li

poor safety, low efficiency, and low resolution of the MSAP technique involving polyacrylamide gel electrophoresis, Xu et al. (2005) introduced a fluorescence labeling system with capillary electrophoresis for MSAP, named F-MSAP, which is safe for

Free access

Yali He and Bingru Huang

. Electrophoresis for isozyme assays. Samples were subjected to discontinuous polyacrylamide gel electrophoresis under nondenaturing, nonreducing conditions as described by Laemmli (1970) with some modifications. SOD was detected on 10.8% acrylamide gels, and

Free access

Qianqian Shi, Xiaoxiao Zhang, Xiang Li, Lijuan Zhai, Xiaoning Luo, Jianrang Luo, Lixia He, Yanlong Zhang, and Long Li

, CA) at Biomarker Technologies (Beijing, China). First, sRNAs (18–30 nt) were isolated from the total RNA by 15% TBE–urea denaturing polyacrylamide gels electrophoresis, and a 5′ RNA adaptor (GTTCAGAGTTCTACAGTCCGACGATC) and 3′ RNA adaptor

Free access

Sasmita Mishra, Scott Heckathorn, Jonathan Frantz, Futong Yu, and John Gray

by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), using 12% acrylamide, 16 × 20-cm gels (50 μg of total protein per lane) (e.g., Heckathorn et al., 2002 ). Following electrophoresis, gels were stained for total proteins using

Free access

Wei Hao, Rajeev Arora, Anand K. Yadav, and Nirmal Joshee

next day, samples were centrifuged at 15,800 × g for 30 min, yielding supernatant as the source of leaf tissue protein for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Protein concentration was determined by a modification