Search Results

You are looking at 41 - 50 of 498 items for :

  • allele identification x
  • Refine by Access: All x
Clear All
Free access

Riaz Ahmad, Darush Struss, and Stephen M. Southwick

We evaluated the potential of microsatellite markers for use in Citrus genome analysis. Microsatellite loci were identified by screening enriched and nonenriched libraries developed from `Washington Navel' Citrus. Microsatellite-containing clones were sequenced and 26 specific PCR primers were selected for cross-species amplification and identification of cultivars/clones in Citrus. After an enrichment procedure, on average 69.9% of clones contained dinucleotide repeats (CA)n and (CT)n, in contrast to <25% of the clones that were identified as positive in hybridization screening of a nonenriched library. A library enriched for trinucleotide (CTT)n contained <15% of the clones with (CTT)n repeats. Repeat length for most of the dinucleotide microsatellites was in the range of 10 to 30 units. We observed that enrichment procedure pulled out more of the (CA)n repeats than (CT)n repeats from the Citrus genome. All microsatellites were polymorphic except one. No correlation was observed between the number of alleles and the number of microsatellite repeats. In total, 118 putative alleles were detected using 26 primer pairs. The number of putative alleles per primer pair ranged from one to nine with an average of 4.5. Microsatellite markers discriminated sweet oranges [Citrus sinensis (L.) osb], mandarin (Citrus reticulata Blanco), grapefruit (Citrus paradisi Macf.), lemon [Citrus limon (L.) Burm.f.], and citrange (hybrids of trifoliate orange and sweet orange), at the species level, but individual cultivars/clones within sweet oranges, mandarins and grapefruit known to have evolved by somatic mutation remained undistinguishable. Since these microsatellite markers were conserved within different Citrus species, they could be used for linkage mapping, evolutionary and taxonomic study in Citrus.

Free access

Darush Struss, Riaz Ahmad, Stephen M. Southwick, and Manuela Boritzki

Simple sequence repeats (SSRs) and amplified fragment-length polymorphisms (AFLPs) were used to evaluate sweet cherry (Prunus avium L.) cultivars using quality DNA extracted from fruit flesh and leaves. SSR markers were developed from a phage library using genomic DNA of the sweet cherry cultivar Valerij Tschkalov. Microsatellite containing clones were sequenced and 15 specific PCR primers were selected for identification of cultivars in sweet cherry and for cross-species amplification in Prunus. In total, 48 alleles were detected by 15 SSR primer pairs, with an average of 3.2 putative alleles per primer combination. The number of putative alleles ranged from one to five in the tested cherry cultivars. Forty polymorphic fragments were scored in the tested cherry cultivars by 15 SSRs. All sweet cherry cultivars were identified by SSRs from their unique fingerprints. We also demonstrated that the technique of using DNA from fruit flesh for analysis can be used to maintain product purity in the market place by comparing DNA fingerprints from 12 samples of `Bing' fruit collected from different grocery stores in the United States to that of a standard `Bing' cultivar. Results indicated that, with one exception, all `Bing'samples were similar to the standard. Amplification of more than 80% of the sweet cherry primer pairs in plum (P. salicina), apricot (P. armeniaca) and peach (P. persica L.) showed a congeneric relationship within Prunus species. A total of 63 (21%) polymorphic fragments were recorded in 15 sweet cherry cultivars using four EcoRI-MseI AFLP primer combinations. AFLP markers generated unique fingerprints for all sweet cherry cultivars. SSRs and AFLP polymorphic fragments were used to calculate a similarity matrix and to perform UPGMA cluster analysis. Most of the cultivars were grouped according to their pedigree. The SSR and AFLP molecular markers can be used for the grouping and identification of sweet cherry cultivars as a complement to pomological studies. The new SSRs developed here could be used in cherry as well as in other Prunus species for linkage mapping, evolutionary and taxonomic study.

Free access

Claudio Cantini, Amy F. Iezzoni, Warren F. Lamboy, Manuela Boritzki, and Darush Struss

The U.S. Department of Agriculture (USDA), Agricultural Research Service (ARS) tetraploid cherry (Prunus L. sp.) collection at Geneva, N.Y., contains ≈75 accessions of sour cherry (P. cerasus L.), ground cherry (P. fruticosa Pall.), and their hybrids. Accurate and unambiguous identification of these accessions is essential for germplasm preservation and use. Simple sequence repeats (SSRs) are currently the markers of choice for germplasm fingerprinting because they characteristically display high levels of polymorphism. Recently SSR primer pairs from sweet cherry (P. avium L.), sour cherry, and peach [(P. persica L. Batsch (Peach Group)] have been reported. Ten SSR primer pairs were tested on 59 tetraploid cherry accessions to determine if they could differentiate among the accessions. Scorable SSR fragments were produced with all primer-accession combinations. The cherry accessions exhibited high levels of polymorphism with 4 to 16 different putative alleles amplified per primer pair. Most of the putative alleles were rare with frequencies <0.05. Heterozygosity values ranged from 0.679 to 1.00, while gene diversity values ranged from 0.655 to 0.906. The primer pairs differentiated all but two of the 59 cherry accessions. Based upon the ability of the SSR data to differentiate the cherry accessions and the high level of gene diversity, we propose that all the tetraploid cherry accessions in the USDA/ARS collection be fingerprinted to provide a mechanism to verify the identity of the individual accessions. The fingerprinting data are available on the World Wide Web ( so that other curators and scientists working with cherry can verify identities and novel types in their collections and contribute to a global database.

Free access

Monica J. Norby and Michael J. Havey

Phytophthorainfestans is the casual agent of late blight and is a major threat to potato production worldwide. There are no curative control agents available and resistance genes offer promise in controlling late blight. To date, the primary source of late-blight resistance has been from hexaploid (6x) [4 Endosperm Balance Number (EBN)] Solanum demissum. Mexican diploid (2x) (1EBN) Solanum species possess a wealth of late-blight resistances, but have been neglected due to crossing barriers. Manipulation of EBN and ploidies should allow integration of 2x (1EBN) germplasm into cultivated potato. Synteny between late-blight resistance loci from Solanum species of disparate ploidies and EBNs may facilitate the identification of unique resistance alleles and loci. Isolate MSU96 (US8/A2) of P. infestans revealed a late-blight resistance locus (Rpi1) from 2x(1EBN) S. pinnatisectum (PI 253214) that mapped to chromosome seven (MGG 265:977-985). MSU96 was also avirulent on the late-blight differential R9-Hodgson 2573 (LB3), revealing the presence of the avirulence gene for R9 originating from S. demissum. To test the relationship between Rpi1 and R9, we evaluated a family segregating for R9 and revealed that it does not map to chromosome seven. The independent inheritance of R9 and Rpi1 indicates that Rpi1 is a unique resistance locus. We are conducting a variety of crossing schemes to introgress Rpi1 into cultivated potato.

Free access

Timothy A. Rinehart, Brian E. Scheffler, and Sandra M. Reed

Using 14 codominant microsatellite markers that amplify loci across 14 different Hydrangea L. species, we analyzed gene diversity and genetic similarity within Hydrangea. Samples also included Dichroa Lour., Platycrater Sieb. and Zucc., and Schizophragma Sieb. and Zucc. genera to establish their relatedness to Hydrangea species since previous work suggests they may be closely related. Our results support the close affiliation between Macrophyllae E.M. McClint. and Petalanthe (Maxim.) Rehder subsections and their separation from the other Hydrangea species. Most of the Hydrangea species analyzed cluster within their designated sections and subsections; however, genetic distance between species within each subsection varied considerably. Our data suggest that morphological analyses which labeled H. serrata (Thunb.) Ser. as a subspecies of H. macrophylla (Thunb. Ex J.A. Murr.) Ser. are probably more accurate than recent genome size data suggesting H. macrophylla ssp. macrophylla (Thunb.) Ser. and H. macrophylla ssp. serrata (Thunb.) Makino are separate species. Gene diversity estimates indicate that 64.7% of the total diversity is due to differences between species and 49.7% of the overall variation is due to differences between subsections. Low diversity suggests a lack of gene flow between species and subsections and underscores the difficulty in making wide hybrids. Since only 35.3% of the genetic variation is common to all species, unique alleles were used to develop a molecular key for unambiguous species identification and interspecific hybrid verification. Genetic similarity estimates for all 85 samples suggests a roadmap for introgressing horticulturally important traits from different Hydrangea species.

Free access

Gerald S. Dangl, Keith Woeste, Mallikarjuna K. Aradhya, Anne Koehmstedt, Chuck Simon, Daniel Potter, Charles A. Leslie, and Gale McGranahan

One hundred and forty-seven primer pairs originally designed to amplify microsatellites, also known as simple sequence repeats (SSR), in black walnut (Juglans nigra L.) were screened for utility in persian walnut (J. regia L.). Based on scorability and number of informative polymorphisms, the best 14 loci were selected to analyze a diverse group of 47 persian walnut accessions and one J. hindsii (Jepson) Jepson ex R.E. Sm × J. regia hybrid (Paradox) rootstock. Among the 48 accessions, there were 44 unique multi-locus profiles; the accessions with identical profiles appeared to be synonyms. The pairwise genetic distance based on proportion of shared alleles was calculated for all accessions and a UPGMA (unweighted pair group method with arithmetic mean) dendrogram constructed. The results agree well with what is known about the pedigree and/or origins of the genotypes. The SSR markers distinguished pairs of closely related cultivars and should be able to uniquely characterize all walnut cultivars with the exception of budsports. They provide a more powerful and reliable system for the molecular characterization of walnut germplasm than those previously tested. These markers have numerous applications for the walnut industry, including cultivar identification, verification of pedigrees for cultivar and rootstock breeding programs, paternity analysis, and understanding the genetic diversity of germplasm collections.

Free access

Júlia Halász, Attila Hegedűs, Zoltán Szabó, József Nyéki, and Andrzej Pedryc

-alleles and correlation of reported S genotypes Plant Breed. 124 188 196 Sánchez-Pérez, R. Dicenta, F. Martínez-Gómez, P. 2004 Identification of S -alleles in almond using multiplex PCR Euphytica 138

Free access

Hitomi Umemura, Katsuhiro Shiratake, Shogo Matsumoto, Tsutomu Maejima, and Hiromitsu Komatsu

of the S 25 cDNA from ‘McIntosh’ apple and an S 25 -allele identification method J. Hort. Sci. Biotechnol. 77 724 728 Kitahara, K. Matsumoto, S. 2002b Sequence of the S 10 cDNA from ‘McIntosh’ apple and a PCR-digestion identification method

Free access

Júlia Halász, Andrzej Pedryc, Sezai Ercisli, Kadir Ugurtan Yilmaz, and Attila Hegedűs

). For the identification of the S C -haplotype, a two-step approach was used. An allele-specific reverse primer, AprSC8R (CTAATAACTAAATGCTAAAGAGCA) was designed to selectively amplify the S C / S 8 - RNase allele ( Fig. 1 ) and was used in combination

Free access

Takashi Akagi, Yumi Takeda, Keizo Yonemori, Ayako Ikegami, Atsushi Kono, Masahiko Yamada, and Shinya Kanzaki

(arrows indicate the primers). Primers with an asterisk were used in quantitative real-time PCR analysis for M ast ( Table 3 ). Materials and Methods Identification of an ast-linked marker allele conserved among cultivars. To confirm