Abstract
Agrobacterium rhizogenes transformation is a more rapid method of obtaining transgenic and edited rubber dandelion (Taraxacum kok-saghyz) plants than Agrobacterium tumefaciens. The hairy root rol genes are present alongside transgenes after transformation, and they change the morphology of rubber dandelion significantly. Although these rol genes are useful visual markers indicating successful transformation of rubber dandelion, they modify the phenotype induced by the target transgenes and are ultimately detrimental to agronomic traits. Fortunately, the rol genes can be removed by conventional plant breeding because they segregate in progeny separately from the targeted transgenes. However, it is preferable to have preliminary identification of promising effects induced by transgenes or gene edits before rol gene removal so that only the best plants are used for breeding. Therefore, the goal of this research was to characterize rol– and rol+ plant morphology so that, in the future, rol+ transgene+ plants can be easily distinguished from rol+ transgene– plants. This requires that rol gene–induced morphological changes and simply assayed physiological traits are first characterized thoroughly so that transgene changes may be observed. Taproot formation is reduced or eliminated in rubber dandelion by rol genes, and rol-induced hairy roots are identifiable easily because they grow shallowly in potting soil, so only partial unearthing is needed. Both leaf and flower numbers are increased by rol genes, but leaves and flowers are smaller than in rubber dandelion wild type with longer stalks. The rosette doming phenotype caused by the induction of a large number of leaf primordia is obvious in rooted plants as young as 1 month old. Photosynthetic rates are reduced significantly in rol+ plants, although growth is not. An accurate description of the morphology of rubber dandelion after A. rhizogenes transformation may allow for initial selection of promising transformed plants before confirmation with polymerase chain reaction, by phenotypic comparison of plants expressing transgenes and the rol gene, with those only expressing the rol gene.
Different species of Agrobacterium are used in biotechnology to insert genes into plants and improve traits. In nature, these bacteria infect plants and insert their genes into a host’s nuclear chromosomes via a virulent plasmid. After this plasmid enters host cells, it incorporates its transfer DNA (tDNA) into the host genome. Researchers have modified this mechanism by replacing viral tDNA with genes of interest (Tzfira and Citovsky 2006). Two species of Agrobacterium have been used by our research group: Agrobacterium tumefaciens and Agrobacterium rhizogenes. Although differences between these two systems will be discussed more thoroughly, greater transformation rates have been found in Taraxacum species using A. rhizogenes than A. tumefaciens (Bae et al. 2005; Lee et al. 2004).
Agrobacterium tumefaciens causes crown gall disease in plants. Crown galls are tumorous plant growths that form calluses of unorganized plant tissue (Gelvin 1990). Agrobacterium tumefaciens infects plants by integrating tDNA from its tumor-inducing plasmid into host cells. Transfer DNA contains oncogenes that cause overproduction of auxins and cytokinins, which cause galls to form. Oncogenes also trigger production of opines, which are low-molecular weight compounds that A. tumefaciens bacteria consume for carbon and nitrogen (Gelvin 1990; Tzfira and Citovsky 2006). Researchers have removed the tDNA responsible for producing crown galls from A. tumefaciens while maintaining the tumor-inducing plasmid’s ability to insert a foreign DNA into plant cells (Ream 2009).
Agrobacterium rhizogenes causes hairy root disease. Hairy root disease is characterized by the abundant production of fuzzy adventitious roots from the site of bacterial infection (Gelvin 1990). Although A. rhizogenes produces different effects in plants than A. tumefaciens, both species insert virulent plasmids using similar mechanisms, and both result in plants expressing bacterial tDNA (Gelvin 1990). Morphological changes are induced by the root-inducing virulent plasmid of A. rhizogenes. Like A. tumefaciens, plant auxin levels are increased, but the A. rhizogenes root loci (rol) genes in the tDNA increase plant cell sensitivity to auxin by 100 to 1000-fold. This increased sensitivity is the primary cause of hairy root formation (Gelvin 1990). For clarity, in the rest of this article, plants containing rol genes are referred to as rol+ and those without rol genes are referred to as rol–.
Crown galls from A. tumefaciens–infected plants rarely produce new plants capable of rooting without the addition of plant growth regulators (Bae et al. 2005; Gelvin 1990). In contrast, A. rhizogenes–infected roots are able to regenerate new plants that carry tDNA, whereas—most often demonstrated in tobacco (Nicotiana tabacum) as a model—this has also been demonstrated in carrot (Daucus carota) and morning glory (Convolvulus arvensis) (Durand-Tardif et al. 1985; Gelvin 1990; Tepfer 1984). In most species, complete plants cannot be regenerated by A. rhizogenes–infected roots, although applications are still reported. Roots of the marshmallow plant (Althaea officinalis) were infected and propagated in liquid media to produce a candidate protein for destroying human immunodeficiency virus (Drake et al. 2013). Taraxacum species can fully regenerate and can do so without the addition of plant growth hormones (Gelvin 1990; Zhang et al. 2015). Thus, researchers can choose between these two Agrobacterium species based on the goals of their study.
Taraxacum kok-saghyz (rubber dandelion) is a plant species that produces high-quality natural rubber within its root laticifers and is being developed as a temperate climate and/or hydroponic crop (Cornish et al. 2019). However, rubber dandelion currently lacks ideal agronomic traits, impeding a profitable rubber yield, and thus is being improved via gene insertions and gene editing (Cherian et al. 2019; Men et al. 2018; Salehi et al. 2021). Several Taraxacum species have been transformed with A. tumefaciens and/or A. rhizogenes. In Taraxacum platycarpum leaf disks, the stable transformation rate (transgenic plants per number of transformed tissue pieces) using A. tumefaciens was ∼1% to 5% (Bae et al. 2005). The transformation rate using root fragments via A. rhizogenes was 76.5% in the same species (Lee et al. 2004). Although transformation using A. tumefaciens has been achieved in Taraxacum brevicorniculatum, a species closely related to rubber dandelion, transformation efficiency was not provided (Post et al. 2012). Taraxacum brevicorniculatum transformation using A. rhizogenes has a rate of 15.7% (Zhang et al. 2015). Agrobacterium tumefaciens and A. rhizogenes transformation rates in rubber dandelion were 21.9% (Zhao L, unpublished data) and 24.7% (Zhang et al. 2015), respectively. Time to regenerate plants fully and prepare them for soil growth has been reported as 67 to 81 d for A. tumefaciens transformation (Collins-Silva et al. 2012). However, using both these Agrobacterium species, we find that A. tumefaciens transformants require 168 d before acclimation can begin whereas A. rhizogenes transformants are ready in only 70 d (unpublished data). Given the greater transformation rates and shorter regeneration times using A. rhizogenes, we have adopted this method of genetic transformation for most of our transformation research.
Currently, polymerase chain reactions (PCRs) are required to confirm the presence of both transgenes and rol genes after transformation. However, new methods are desired to select rol+ plants solely by phenotype to reduce the number of PCRs required. Almost all rubber dandelion plants are self-incompatible (i.e., cannot be self-pollinated to produce progeny) (Luo et al. 2017). Hybridization with wild-type plants allows the transgenes and rol genes to segregate independently in the T1 and T2 generations. Effective selection criteria to remove rol+, transgene– plants before performing PCR or further crossing with wild-type plants would save time and resources. Thus, an efficient protocol for removing hairy root phenotypes from the population, without inadvertently eliminating genotypes expressing transgenes, is needed.
Therefore, the goal of this research was to characterize rol– and rol+ plant morphology so that, in the future, rol+ transgene+ plants can be distinguished from rol+ transgene– plants. In addition, we compared the wild-type morphology of plants grown directly from seed with those selected as rol– and regenerated to assess potential changes caused by the transformation, selection, and regeneration protocols used.
Materials and Methods
Production of plants with specific rol traits.
T0 plants were made by transforming roots with rol+ or empty vector (rol–) plasmids using A. rhizogenes–mediated transformation followed by regeneration, acclimation, and transfer to pots using established methods (Zhang et al. 2015). For all generations, after 1 month of growth, rooted plants were transplanted into 8.9- × 22.9-cm rectangular black plastic pots (Mini-Tree Pot TP49CH; Stuewe and Sons Inc., Tangent, OR, USA) supported by 40-cm square plastic trays (Square Tray TRAY6, Stuewe and Sons Inc.) with a combination of soilless media and field soil. Plants were grown in a greenhouse with a 12-/12-h (light/dark) photoperiod at 22 °C at The Ohio Agricultural Research and Development Center, Wooster, OH (lat. 81.93°55′19.4"N; long. 40°46′20.9"W). Because rubber dandelion is self-incompatible, flowering T0 plants were crossed with three different genetic backgrounds of nontransgenic plants to produce T1 generation seeds as described (Zhang et al. 2015). These T1 seeds were then crossed with other T1 progeny from a different nontransgenic parent to ensure seeds could be produced in the future. T2 plants were grown in a greenhouse, as described earlier. Agrobacterium rhizogenes transgene segregation in a Mendelian pattern (Budar et al. 1986; Tepfer 1984) was first demonstrated in tobacco, one of several species that can produce plants from transformed roots. Thus, transgenic plants crossed with wild types produce heterozygous T1 transgenic plants for both transgenes and rol genes (Budar et al. 1986). Because of the different genetic background of the wild-type plants used to create the T1 generation, they were interbred to create the T2 generation and beyond. Transgenes and rol genes segregate independently in progeny as rol+ transgene–, rol+ transgene+, rol– transgene–, or rol– transgene+, the desired genotype. These differing genotypes were confirmed by PCR. We selected rol+ transgene– and rol– transgene– plants for this study, and they are called rol+ and rol– in the rest of the article.
Rubber dandelion plants with rol+ and rol– phenotypes without transgenes were produced by selection and PCR confirmation within a T2 population. This morphological study was performed on the T3 progeny. T3 plants were used for further analysis, and plants of rol+ transgene– and rol– transgene– genotypes were planted in 3.81- × 13.97-cm black plastic cones (Ray Leach “stubby cell” cone SC7R, Stuewe and Sons Inc.) supported by 98-cell plastic trays (Ray Leach “cone-tainer” RL98, Stuewe and Sons Inc.) containing peat-based soilless media (Pro-Mix; Premier Tech Horticulture, Rivière-du-Loup, QC, Canada). Alongside them were wild-type rubber dandelion plants grown from seed of the Bravo population. Bravo is a population produced by crossing a high-yield rubber dandelion with rubber dandelion accession HR009, after which progeny were propagated clonally (Luo et al. 2018). Because Bravo is a higher rubber yielding population, derived from U.S. Department of Agriculture accession KAZ08-017 (W635172), it is useful to compare rubber yield data from new rubber dandelion germplasm to Bravo. This will provide insight into rubber yield improvements in new rubber dandelion selections and enable progress toward establishment of high-rubber cultivars. The number in each plant group was rol–, n = 8; rol+, n = 11; and Bravo (wild type), n = 12. Six of each were selected randomly for diurnal photosynthesis measurements.
Plants were greenhouse-grown as described and were transplanted after 1 month. During transplanting, healthy plants were selected with identifiable traits; a smaller selection of plants was used for the rest of this study. Standard morphology and the hairy “dome” morphology were used at this stage to guide plant selection. These morphologies are discussed thoroughly in the Results section. Plants were then grown to 10 months of age. Only rol+/transgene–, rol–/transgene–, and Bravo wild-type plants were used for trait analysis.
Polymerase chain reactions.
DNA was extracted as described (Vilanova et al. 2020) using fresh or lyophilized rubber dandelion leaves. For PCR, forward and reverse primer sequences were designed for rol genes and transgenes using the Primer3 program (Koressaar and Remm 2007; Untergasser et al. 2012). The primers used were rolC new_F: AGTCTTAAGGTAGGCGACGT and rolC new_R: GTTGCTGGCATAAAGGTCGA. PCR primers and sample DNA were placed in a thermal cycler (C1000 Touch™; Bio-Rad Laboratories, Hercules, CA, USA) for annealing, elongation, and denaturation. Times and temperatures were an initial 5-min denaturation phase at 95 °C, 35 cycles of 40 s denaturation at 95 °C, 60 s annealing at 54 °C, 60 s elongation at 68 °C, and a final 5-min extension phase at 68 °C (Iaffaldano et al. 2016). The PCR products were then separated by gel electrophoresis using a 2% agarose gel with ethidium bromide. PCR times were adjusted based on band clarity in gels (Iaffaldano et al. 2016).
Photosynthetic rates.
Carbon dioxide assimilation rates (measured in micromoles per square meter per second) of rol+, rol–, and rubber dandelion Bravo (seed-generated wild type) plants and associated parameters collected automatically (three of each on the first day followed by another three on the next day) were measured using a portable photosynthesis system (LI-6400XT; LI-COR BioSciences, Lincoln, NE, USA) according to manufacturer’s instructions when plants were 10 months old (Jul 2020). Diurnal curves were produced by measuring the assimilation rate five times throughout the day: sunrise, midmorning, solar noon, midafternoon, and sunset. Times for sunrise, solar noon, and sunset were determined using the National Oceanic and Atmospheric Administration Solar Calculator (National Oceanic and Atmospheric Administration 2022) given latitude and longitude. Latitude and longitude of the Ohio Agricultural Research and Development Center is 40.7787°N and 81.9308°W, respectively, according to The Ohio State University (2022) Weather System.
For most plants, measurements were taken from the same leaf throughout the day. However, some similar leaves from the same plants were used if the original leaf was torn or pulled from the plant. The external infrared gas analyzer chamber was 6 cm2, which was used as the input leaf size for all samples while measurements were being taken. Because rubber dandelion leaves, although long, are often too narrow to cover the entire 6-cm2 chamber, photosynthetic rates were adjusted for actual leaf area calculated using the ImageJ image processing program (Rasband 2018). Because rol+ plants have smaller leaves than rol– and wild type, this issue affected rol+ plant measurements more strongly.
Rubber quantification.
Rubber dandelion plants not used for photosynthesis analysis were harvested in Jul 2020, at 10 months old, whereas the plants used for photosynthesis analysis were harvested in late Dec 2020, at 15 months old. Plants were removed from their tree pots and excess dirt was shaken loose from the roots. Each whole plant was weighed, then leaves were cut from the plant with a knife. The cut was made just above the plant’s crown to prevent latex leaking from the crown or from the roots. Roots (including crown) were weighed, then placed in brown paper bags and dried in a 50 °C oven for at least 2 weeks before being ground to a powder using an analytical grinding mill (Basic analytical mill IKA A10; MilliporeSigma, Billerica, MA, USA). The rubber content in powdered roots was quantified using an infrared spectroradiometer (FieldSpec® 3 Spectroradiometer; Analytical Spectral Devices Inc., Boulder, CO, USA) and a previously developed computer model (r2 = 0.93, df = 298), based on rubber dandelion root rubber quantification reference data generated using accelerated solvent extraction (Ramirez-Cadavid et al. 2018), to predict the rubber concentration of dried root samples (measured in milligrams rubber per gram dry root). Rubber yield (measured in milligrams rubber per plant) was determined by multiplying root dry weight (measured in grams per plant) by predicted rubber concentration.
Statistical analysis.
Photosynthesis data were analyzed using one-way analysis of variance (ANOVA) using statistical software (SAS version 9.4; SAS Institute Inc, Cary NC, USA), with five replications in a completely randomized design. Time of day was analyzed as a repeated measure using the REPEATED option within PROC GLM. Although photosynthesis was measured over 2 d, there was no effect of “day,” and this was excluded from the ANOVA to conserve degrees of freedom. Whole-plant fresh weight, root fresh weight, root dry weight, and rubber content were analyzed using one-way ANOVA using SAS version 9.4, with five replications in a completely randomized design. The Shapiro-Wilks test of residuals, the Levene test, plots of residuals vs. predicted values, and normal-quantile plots were used to confirm that data conformed to assumptions of normality and homogeneity of variance (data not shown). Photosynthesis and phenotypic measurements conformed to ANOVA assumptions; however, stomatal conductance (gs) measurements did not conform to the assumption of normality and were transformed using x-0.5; data presented are the untransformed means whereas P values are from the transformed analysis.
Results
Plant morphology.
Rubber dandelion leaves were thicker and more blue-green than the yellow-green leaf color of the common dandelion (Taraxacum officinale). Rubber dandelion has a taproot or multiple roots and often branching roots. rol– plants had the same basic morphological features as Bravo (wild-type) plants; however, both rol– tops and roots appeared smaller than Bravo plants (Fig. 1A and B), even though the sizes were not significantly different (P > 0.05) because of large interplant variation.
Whole plant fresh weight (A), root fresh weight (B), root dry weight (C), rubber concentration (D), and rubber yield € in rol– (green), rol+ (blue), and wild-type (Bravo) (brown) rubber dandelion plants (P > 0.05). Rubber yield was calculated by multiplying root dry weight with rubber concentration. The bars are means ± SD. The number in each mean varies as follows: (A) rol–, n = 6; rol+, n = 11; Bravo, n = 10. (B–E) rol–, n = 8; rol+, n = 11; Bravo, n = 12.
Citation: Journal of the American Society for Horticultural Science 148, 1; 10.21273/JASHS05217-22
The morphology of all rol+ plants was distinctly different from rol– and wild-type (Bravo) plants. Rosettes of rol+ plants had many more and smaller leaves than wild-type plants, and formed a dome, which was not seen in the wild-type or rol– plants. rol+ plants were more variable than the wild-type or rol– plants (Fig. 1A–C). However, root rubber concentration was almost identical among the genotypes (Fig. 1D), and differences in rubber yield (Fig. 1E) mirrored differences in root dry weight (Fig. 1C) because rubber yield is the product of concentration and root dry weight. Plants removed from cones had a variety of root lengths and shapes.
They fit into two categories: “wild type” (rol–, including Bravo) and “hairy” (rol+). Wild-type roots had a taproot and thick lateral roots, although the number and size of these roots varied. Hairy roots did not have a taproot and had many tangled, thin roots that spread through the soil. In general, hairy roots did not penetrate as deeply as standard roots, but there was still variation in root depth within cones. Although all plants grew much larger after their transplantation to tree pots, their general morphologies remained the same.
rol+ roots grew much shallower and were much thinner than roots of rol– plants (Fig. 2A and B). rol+ leaves were narrower and much more abundant, causing a rosette dome phenotype of vertical and horizontal leaves (Fig. 3A and B), a leaf trait that can be used easily to confirm rol+ transgenesis. rol+ plants also have smaller flowers than rol– plants. These phenotypes were observed in all rol+ plants studied.
Morphology of 10-month-old rol+ (A) and rol– (B) rubber dandelion plants after harvest from soil. The scale is in centimeters with the total length shown.
Citation: Journal of the American Society for Horticultural Science 148, 1; 10.21273/JASHS05217-22
Morphology of 6-month-old rol+ and rol– plants in planar (A) and side (B) views. Plants on the left are rol+ and plants on the right are rol–. The leaf proliferation and dome shape of the rosettes is clear after 1 month.
Citation: Journal of the American Society for Horticultural Science 148, 1; 10.21273/JASHS05217-22
Photosynthesis.
Photosynthetic rates were fit to quadratic curves for each plant group (genotype) and showed diurnal variation throughout the day, with a general trend of a rising and falling photosynthetic rate as the sun rose and set. On average, rol+ plants had a lower carbon dioxide assimilation rate (Fig. 4) than rol– or wild-type plants, which were similar to each other. Thus, rol+ plants may sequester less carbon than rol– or wild-type Bravo plants. The repeated measures ANOVA showed a statistically significant time effect (df = 4,12; P = 0.004) and a nonsignificant time × genotype interaction (df = 8,24; P = 0.839). Genotypes were significantly different at two time periods (between 1400 and 1800 HR) (df = 2,15; P < 0.07), with rol+ plants having lower assimilation rates than the other two genotypes. However, gs differed over time (df = 4,12; P = 0.001), but not among genotypes (df = 2,15; P = 0.180–0.664) or time × genotype interaction (df = 8,24; P = 0.675).
Diurnal photosynthetic rates collected on 28 and 29 Jul 2020 for six each of rol– (blue), rol+ (orange), and wild-type [Bravo (gray)] rubber dandelion plants. Photosynthetic rates were fit to quadratic curves for each plant group and the means are plotted. NS, not significant. † indicates solar noon.
Citation: Journal of the American Society for Horticultural Science 148, 1; 10.21273/JASHS05217-22
Leaf senescence.
Although yellowed and dead leaves were removed as a standard practice to maintain rubber dandelion plant health, rol– and Bravo rosette leaves senesced at the base of the rosette whereas rol+ leaves senesced throughout the rosette.
Flowers and seed.
Seed from rol+ plants was noticeably smaller than rol– seed (Fig. 5A and B). Germination rates of T2 seed grown to produce the T3 plants were inhibited by rol+. Although rol– was also lower than Bravo wild types, which had not passed through transformation, regeneration, and acclimation, the 14-d germination rates were 70%, 80%, and 93% for rol+, rol–, and Bravo, respectively. The rol+ flowers and seed heads with pappus were smaller in diameter than rol– plants, but had longer flower stalks (Fig. 6). Flowers produced viable seed when fertilized with pollen of different genotypes.
Seeds from rol– (A) and rol+ (B) rubber dandelion plants. Numbers on the ruler are centimeters. The mean weight of rol– seed was 0.546 mg/seed and rol+ seed was 0.233 mg/seed.
Citation: Journal of the American Society for Horticultural Science 148, 1; 10.21273/JASHS05217-22
Flowering plants of rubber dandelion in planar (A and B) and side (C and D) vies of rol+ (A and C) and rol– (B and D) plants. Bravo plants (not shown) are similar to rol– plants.
Citation: Journal of the American Society for Horticultural Science 148, 1; 10.21273/JASHS05217-22
Discussion
The greatest benefits of using A. rhizogenes are increased transformation efficiency during transgene introduction and rapid plant regeneration; the greatest detriments are during breeding and selection for high-performing transgene+ plants, because the rol+ phenotype may obscure phenotypic traits conferred by the target genes. This is opposite from A. tumefaciens–mediated transformation, because although the transformation efficiency is less, breeding and selections are simpler.
This study showed that wild-type and rol– plants had similar morphology, size, rubber yield, and carbon dioxide assimilation rates, suggesting there were no lasting negative effects caused by tissue culture and regeneration.
The most easily identified phenotype distinguishing rol+ from rol– in soil-grown plants was the dome leaf bunching observed in rol+ plants (Fig. 3). This trait manifests within the first month of rol+ rubber dandelion growth independent of other transgenes or when leaves are large enough to be sampled for DNA extraction and PCR confirmation of transgene expression. Because this dome configuration occurred in all rol+ plants (with different underlying heterozygous genotypes), this is a direct effect of rol+. This is not surprising, because auxin plays a primary role in leaf primordia initiation and leaf development (Xiong and Jiao 2019), and rol+ plants are known to overproduce auxin as well as to cause the host plant to become more sensitive to this plant growth regulator (Gelvin 1990). The greater variability of rol+ plants suggests that the susceptibility of the underlying genotypes to elevated auxin differed even though all were more sensitive to auxin than wild-type plants (Fig. 1A–C). However, rubber concentration, although known to be sensitive to environmental stimuli, such as cold temperatures (Salehi et al. 2021), does not appear sensitive to auxin (Fig. 1D) because it was the same across the genotypes. The more vertical aspect of the leaves in rol+ rosettes is likely an indirect effect of leaf crowding, because this also happens in wild-type plants when they are planted at high density (Bates et al. 2019). The rol+ root phenotype is also useful in differentiating rol+ and rol– plants because the rol+ plants usually lack a taproot and have thinner, shallower, and more abundant roots. Although this root morphology can be seen readily in plants grown on transparent media, it can only be observed in soil-grown plants during transplanting or harvesting, or other deliberate removal from soil, so is much less useful for sorting rol+ from wild-type plants in greenhouses than the rosette doming phenotype.
Taraxacum platycarpum transformed using A. rhizogenes displayed similar root phenotypes to rol+ rubber dandelion. High numbers of hairy roots were reported, and no taproot formed in rol+ plants in contrast to wild types (Lee et al. 2004). Agrobacterium rhizogenes–induced morphological changes in carrot and tobacco also are similar to those observed in rubber dandelion, including reduced flower size, leaf wrinkling, and reduced apical dominance, phenotypes that persisted in the progeny of transformed plants (Tepfer 1984). Although rubber dandelion does not have a central stem, its apical meristem is located at its rosette, which likely relates to the leaf bunching observed in rol+ plants. Because carrot and tobacco had reduced apical dominance, the rubber dandelion equivalent may be expressed as excessive leaf growth at its apical meristem rather than the apical dominance traits observed in carrot and tobacco.
The inhibitory effect of rol+ on photosynthetic carbon dioxide assimilation rate (Fig. 4) was not expected because elevated auxin levels more commonly increase plastid size and number, stomatal aperture, and photosynthetic rate, although the relationship of auxin levels to primary metabolism is poorly understood (Tivendale and Millar 2022). The impact of the reduced assimilate is unclear because although mean rol+ root and plant sizes were the smallest (Fig. 1A and B), these differences were not significant at the P < 0.05 level with the number of samples available. Also, although the photosynthetic carbon dioxide assimilation rate was inhibited in the rol+ plants, gs was not. This suggests that an internal inhibition is occurring. For example, auxin treatment of roots represses chloroplast development in Arabidopsis thaliana (Kobayashi et al. 2012) and may reduce growth, cause chlorosis, and induce starch accumulation inhibition of fixed carbon (sugars) transport (Mohajjel-Shoja et al. 2010). Although we did not see significant growth inhibition by rol+ apart from a reduction in seed size (Fig. 5), perhaps something of this nature occurred in our rol+ plants. We did not quantify the storage carbohydrate inulin, chloroplast number, chlorophyll content, or leaf color in our study.
In conclusion, this description of rol+ morphology can guide researchers in differentiating between rol+ and rol– rubber dandelion plants in advance of PCR tests. Plants containing transgenes of interest in the T1 and T2 generation can then be compared with rol+ to detect transgene-induced changes in morphology or photosynthetic rate. This will allow for a more efficient selection process that should allow for more rapid development of transgenic rubber dandelion populations after A. rhizogenes transformation.
References Cited
Bae, T.W., Park, H.R., Kwak, Y.S., Lee, H.Y. & Ryu, S.B. 2005 Agrobacterium tumefaciens-mediated transformation of a medicinal plant Taraxacum platycarpum Plant Cell Tissue Organ Cult. 80 51 57 https://doi.org/10.1007/s11240-004-8807-7
Bates, G.M., McNulty, S.K., Amstutz, N.D., Pool, V.K. & Cornish, K. 2019 Planting density and harvest season effects on actual and potential latex and rubber yields in Taraxacum kok-saghyz HortScience. 54 1338 1344 https://doi.org/10.21273/HORTSCI13986-19
Budar, F., Thia-Toong, L., Van Montagu, M. & Hernalsteens, J.P. 1986 Agrobacterium mediated gene transfer results mainly in transgenic plants transmitting T-DNA as a single mendelian factor Genetics 114 303 313 https://doi.org/10.1093/genetics/114.1.303
Cherian, S., Ryu, S.B. & Cornish, K. 2019 Natural rubber biosynthesis in plants, the rubber transferase complex, and metabolic engineering progress and prospects Plant Biotechnol. J. 17 2041 2061 https://doi.org/10.1111/pbi.13181
Collins-Silva, J., Nural, A.T., Skaggs, A., Scott, D., Hathwaik, U., Woolsey, R., Schegg, K., McMahan, C., Whalen, M., Cornish, K. & Shintani, D. 2012 Altered levels of the Taraxacum kok-saghyz (Russian dandelion) small rubber particle protein, TkSRPP3, result in qualitative and quantitative changes in rubber metabolism Phytochemistry. 79 46 56 https://doi.org/10.1016/j.phytochem.2012.04.015
Cornish, K., Kopicky, S. & Madden, T. 2019 Hydroponic cultivation has high yield potential for TKS https://www.rubbernews.com/technical-notebooks/hydroponic-cultivation-has-high-yield-potential-tks. [accessed 27 Apr 2022]
Drake, P.M.W., de Moraes Madeira, L., Szeto, T.H. & Ma, J.K.C. 2013 Transformation of Althaea officinalis L. by Agrobacterium rhizogenes for the production of transgenic roots expressing the anti-HIV microbicide cyanovirin-N Transgenic Res. 22 1225 1229 https://doi.org/10.1007/s11248-013-9730-7
Durand-Tardif, M., Broglie, R., Slightom, J. & Tepfer, D. 1985 Structure and expression of Ri T-DNA from Agrobacterium rhizogenes in Nicotiana tabacum J. Mol. Biol. 186 557 564 https://doi.org/10.1016/0022-2836(85)90130-5
Gelvin, S.B. 1990 Crown gall disease and hairy root disease: A sledgehammer and a tackhammer Plant Physiol. 92 281 285 https://doi.org/10.1104/pp.92.2.281
Iaffaldano, B.J., Zhang, Y., Cardina, J. & Cornish, K. 2016 CRISPR/Cas9 genome editing of rubber producing dandelion Taraxacum kok-saghyz using Agrobacterium rhizogenes without selection Ind. Crops Prod. 98 356 362 https://doi.org/10.1016/j.indcrop.2016.05.029
Kobayashi, K., Baba, S., Obayashi, T., Sato, M., Toyooka, K., Keränen, M., Aro, E.M., Fukaki, H., Ohta, H., Sugimoto, K. & Masuda, T. 2012 Regulation of root greening by light and auxin/cytokinin signaling in Arabidopsis Plant Cell 24 1081 1095 https://doi.org/10.1105/tpc.111.092254
Koressaar, T. & Remm, M. 2007 Enhancements and modifications of primer design program Primer3 Bioinformatics 23 1289 1291 https://doi.org/10.1093/bioinformatics/btm091
Lee, M.H., Yoon, E.S., Jeong, J.H. & Choi, Y.E. 2004 Agrobacterium rhizogenes-mediated transformation of Taraxacum platycarpum and changes of morphological characters Plant Cell Rep. 22 822 827 https://doi.org/10.1007/s00299-004-0763-5
Luo, Z., Iaffaldano, B.J., Zhuang, X., Fresnedo-Ramírez, J. & Cornish, K. 2017 Analysis of the first Taraxacum kok-saghyz transcriptome reveals potential rubber yield related SNPs Sci. Rep. 7 1 13 https://doi.org/10.1038/s41598-017-09034-2
Luo, Z., Iaffaldano, B.J., Zhuang, X., Fresnedo-Ramírez, J. & Cornish, K. 2018 Variance, inter-trait correlation, heritability, and marker-trait association of rubber yield-related characteristics in Taraxacum kok-saghyz Plant Mol. Biol. Rpt. 36 576 587 https://doi.org/10.1007/s11105-018-1097-8
Men, X., Wang, F., Chen, G.Q., Zhang, H.B. & Xian, M. 2018 Biosynthesis of natural rubber: Current state and perspectives Int. J. Mol. Sci. 20 1 22 https://doi.org/10.3390/ijms20010050
Mohajjel-Shoja, H., Clement, B., Perot, J., Alioua, M. & Otten, L. 2010 Biological activity of the Agrobacterium rhizogenes–derived trolC gene of Nicotiana tabacum and its functional relation to other plast genes IS-MPMI. 24 44 53 https://doi.org/10.1094/MPMI-06-10-0139
National Oceanic and Atmospheric Administration 2022 NOAA solar calculator https://www.esrl.noaa.gov/gmd/grad/solcalc/. [accessed 6 Jun 2022]
Post, J., van Deenen, N., Fricke, J., Kowalski, N., Wurbs, D., Schaller, H., Eisenreich, W., Huber, C., Twyman, R.M., Prüfer, D. & Gronover, C.S. 2012 Laticifer-specific cis prenyltransferase silencing affects the rubber, triterpene, and inulin content of Taraxacum brevicorniculatum Plant Physiol. 158 1406 1417 https://doi.org/10.1104/pp.111.187880
Ramirez-Cadavid, D.A., Valles-Ramirez, S., Cornish, K. & Michel, F.C. 2018 Simultaneous quantification of rubber, inulin, and resins in Taraxacum kok-saghyz (TK) roots by sequential solvent extraction Ind. Crops Prod. 122 647 656 https://doi.org/10.1016/j.indcrop.2018.06.008
Rasband, W.S. 2018 ImageJ https://imagej.nih.gov/ij/. [accessed 6 Jun 2022]
Ream, W. 2009 Agrobacterium tumefaciens and A. rhizogenes use different proteins to transport bacterial DNA into the plant cell nucleus Microb. Biotechnol. 2 416 427 https://doi.org/10.1111/j.1751-7915. 2009.00104.x
Salehi, M., Cornish, K., Bahmankar, M. & Naghavi, M.R. 2021 Natural rubber-producing sources, systems, and perspectives for breeding and biotechnology studies of Taraxacum kok-saghyz Ind. Crops Prod. 170 1 12 https://doi.org/10.1016/j.indcrop.2021.113667
Tepfer, D. 1984 Transformation of several species of higher plants by Agrobacterium rhizogenes: Sexual transmission of the transformed genotype and phenotype Cell 37 959 967 https://doi.org/10.1016/0092-8674(84)90430-6
The Ohio State University 2022 CFAES Weather System https://weather.cfaes.osu.edu//stationinfo.asp?id=1. [accessed 6 Jun 2022]
Tivendale, N.D. & Millar, A.H. 2022 How is auxin linked with cellular energy pathways to promote growth? New Phytol. 233 2397 2404 https://doi.org/10.1111/nph.17946
Tzfira, T. & Citovsky, V. 2006 Agrobacterium-mediated genetic transformation of plants: Biology and biotechnology Curr. Opin. Biotechnol. 17 147 154 https://doi.org/10.1016/j.copbio.2006. 01.009
Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M. & Rozen, S.G. 2012 Primer3: New capabilities and interfaces Nucl. Acids Res. 40 e115 https://doi.org/10.1093/nar/gks596
Vilanova, S., Alonso, D., Gramazio, P., Plazas, M., García-Fortea, E., Ferrante, P., Schmidt, M., Díez, M.J., Usadel, B., Giuliano, G. & Prohens, J. 2020 SILEX: A fast and inexpensive high-quality DNA extraction method suitable for multiple sequencing platforms and recalcitrant plant species Plant Methods 16 1 11 https://doi.org/10.1186/s13007-020-00652-y
Xiong, Y. & Jiao, Y. 2019 The diverse roles of auxin in regulating leaf development Plants 8 243 https://doi.org/10.3390/plants8070243
Zhang, Y., Iaffaldano, B.J., Xie, W., Blakeslee, J.J. & Cornish, K. 2015 Rapid and hormone free Agrobacterium rhizogenes-mediated transformation in rubber producing dandelions Taraxacum kok-saghyz and T. brevicorniculatum Ind. Crops Prod. 66 110 118 https://doi.org/10.1016/j.indcrop.2014.12.013