Development and Application of Genic Simple Sequence Repeat Markers from the Transcriptome of Loquat

in Journal of the American Society for Horticultural Science
View More View Less
  • 1 Institute of Horticulture, Zhejiang Academy of Agricultural Sciences, Shiqio road 139, Hangzhou, P.R. China, 310021
  • 2 Ninghai Agriculture & Forestry Bureau, Ningbo, Zhejiang, P.R. China, 315600
  • 3 Institute of Horticulture, Zhejiang Academy of Agricultural Sciences, Shiqio road 139, Hangzhou, P.R. China, 310021

Deep transcriptome sequencing allows for the acquisition of large-scale microsatellite information, and it is especially useful for genetic diversity analysis and mapping in plants without reference genome sequences. In this study, a total of 14,004 simple sequence repeats (SSRs) were mined from 10,511 unigenes screening of 63,608 nonredundant transcriptome unigenes in loquat (Eriobotrya japonica) with a frequency of 22 SSR loci distributed over 100 unigenes. Dinucleotide and trinucleotide repeat SSRs were dominant, accounting for 20.62%, and 42.1% of the total, respectively. Seventy primer pairs were designed from partial SSRs and used for polymerase chain reaction (PCR) amplification. Of these primer pairs, 54 exhibited amplification and 33 were polymorphic. The number of alleles at these loci ranged from two to 17, and the polymorphism information content values ranged from 0.24 to 0.89. We tested the transferability of 33 SSR polymorphic primer pairs in apple and pear, and the transferability rates in these two species were 90.9% and 87.9%, respectively. A high level of marker polymorphism was observed in apple [Malus ×domestica (66.7%)], whereas a low level was observed in pear [Pyrus sp. (51.5%)]. In addition, the PCR products from seven SSR primer pairs were selected for sequence analysis, and 89.2% of the fragments were found to contain SSRs. SSR motifs were conserved among loquat, apple, and pear. According to our sequencing results for real SSR loci, ≈12,490 SSR loci were present in these loquat unigenes. The cluster dendrogram showed a distinct separation into different groups for these three species, indicating that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the species of Maloideae in the Rosaceae. The results of our identified SSRs should be useful for genetic linkage map construction, quantitative trait locus mapping, and molecular marker-assisted breeding of loquat and related species.


Deep transcriptome sequencing allows for the acquisition of large-scale microsatellite information, and it is especially useful for genetic diversity analysis and mapping in plants without reference genome sequences. In this study, a total of 14,004 simple sequence repeats (SSRs) were mined from 10,511 unigenes screening of 63,608 nonredundant transcriptome unigenes in loquat (Eriobotrya japonica) with a frequency of 22 SSR loci distributed over 100 unigenes. Dinucleotide and trinucleotide repeat SSRs were dominant, accounting for 20.62%, and 42.1% of the total, respectively. Seventy primer pairs were designed from partial SSRs and used for polymerase chain reaction (PCR) amplification. Of these primer pairs, 54 exhibited amplification and 33 were polymorphic. The number of alleles at these loci ranged from two to 17, and the polymorphism information content values ranged from 0.24 to 0.89. We tested the transferability of 33 SSR polymorphic primer pairs in apple and pear, and the transferability rates in these two species were 90.9% and 87.9%, respectively. A high level of marker polymorphism was observed in apple [Malus ×domestica (66.7%)], whereas a low level was observed in pear [Pyrus sp. (51.5%)]. In addition, the PCR products from seven SSR primer pairs were selected for sequence analysis, and 89.2% of the fragments were found to contain SSRs. SSR motifs were conserved among loquat, apple, and pear. According to our sequencing results for real SSR loci, ≈12,490 SSR loci were present in these loquat unigenes. The cluster dendrogram showed a distinct separation into different groups for these three species, indicating that these SSR markers were useful in the evaluation of genetic relationships and diversity between and within the species of Maloideae in the Rosaceae. The results of our identified SSRs should be useful for genetic linkage map construction, quantitative trait locus mapping, and molecular marker-assisted breeding of loquat and related species.

Loquat belongs to the family Rosaceae and is an important evergreen fruit crop native to south–central China (Gisbert et al., 2009a, 2009b). It has become popular with consumers because of its sweet and edible fruit (Lin et al., 2004), which can be sorted into red- and white-fleshed cultivars (Fu et al., 2012). Over 300 cultivars have been recorded and preserved, most of which are landraces with high genetic diversity (Qiu and Zhang, 1996). To more efficiently use these abundant loquat germplasm resources in genetic breeding, they must be evaluated and identified using efficient molecular methods.

Microsatellites or SSR are 1- to 6-bp DNA regions repeated in tandem that are ubiquitous in both prokaryotes and eukaryotes (Gao et al., 2013). As a result, SSRs are simple and efficient markers useful in the analysis of codominance and highly polymorphic lines. SSRs have been used extensively in genetic diversity assessments (Li et al., 2010a), cultivar fingerprinting (Wang et al., 2011), marker-assisted breeding (Gutiérrez et al., 2011), and diversity and linkage map construction studies (Chen et al., 2006; Pazos-Navarro et al., 2011). As a result of the lack of genomic information for most non-model plant species, it is expensive and labor-intensive to develop traditional SSRs from genomic DNA library screening (Temnykh et al., 2001). With the development of next-generation sequencing in transcriptomics, creating transcriptome-level sequence collections has become much more cost-effective. A wealth of genic SSRs, single nucleotide polymorphism, and other genetic markers have been identified and developed for non-model plant species (Li et al., 2013c, 2013d; Mardis, 2008; Zhang et al., 2012a). In comparison with genomic SSR markers, genic SSR markers are based on expressed sequences from coding regions and are potentially tightly linked with functional genes that control important phenotypic characteristics (Ramchiary et al., 2011). Genic SSRs derived from transcriptome or expressed sequence tag (EST) sequences have been widely mined and applied in molecular biology studies for numerous fruit tree species such as pomegranate [Punica granatum (Ono et al., 2011)], litchi [Litchi chinensis (Li et al., 2013a)], highbush blueberry [Vaccinium corymbosum (Rowland et al., 2012)], peach [Prunus persica (Wang et al., 2013), pear [Pyrus pyrifolia (Yue et al., 2014)], and Nules clementine [Citrus clementina (Luro et al., 2008)], but they have not been developed from the loquat transcriptome.

Genic SSRs can also be developed from the data for ESTs (Bouck and Vision, 2006). However, only four loquat ESTs have been submitted to GenBank (as of 1 Jan. 2014), indicating a lack of development of EST-SSR markers in the species. Most of the EST-SSRs used in loquat genetic diversity studies have been derived from apple (Li et al., 2013b). To address this knowledge gap, we report the first development of genic SSR markers based on loquat transcriptome sequences obtained in our laboratory, which provides a valuable resource to complement SSR collections. The detailed information on the transcriptome will be described elsewhere. The aim of this study was to explore the SSR loci of transcriptome sequences in loquat, analyze their distribution regularity, and design primers to test the authenticity and identify the transferability of these SSR loci in other Maloideae species of the Rosaceae. These results will prove very useful for the evaluation of genetic diversity, cultivar identification, and marker-assisted selection in future research.

Materials and Methods

Plant materials.

A total of 33 accessions were used for the development and transferability testing of genic SSR markers in this study. Young leaf samples of 13 loquats and 10 pear cultivars (Table 1) were collected from the Loquat and Pear Germplasm Resources Garden (Yangdu Agricultural Research Station, Institute of Horticulture, Zhejiang Academy of Agricultural Sciences, Hangzhou, P.R. China). Young leaf samples of 10 apple cultivars were collected from the National Germplasm Resources Garden of Apple (Zhengzhou Academy of Agricultural Sciences, Zhengzhou, P.R. China). The names of the cultivars are listed in Table 1.

Table 1.

Cultivars used for genic simple sequence repeat marker amplification and transferability in this study.

Table 1.

DNA isolation.

Genomic DNA for each cultivar was isolated from young leaves using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA) according to the manufacturers recommendations. DNA concentrations were quantified using a spectrophotometer (U-0080D; Hitachi High-Technologies Corp., Tokyo, Japan), and subsamples were run on 1% agarose gels to test for sample integrity (data not shown). All samples were stored at –80 °C until further use.

Mining of SSR based on the transcriptome data set.

A total of 63,608 unigenes were obtained from the ‘Ninghaibai’ loquat fruit transcriptome acquired in our laboratory (unpublished data). The genic SSR loci in the loquat fruit transcriptome were searched from the unigenes using MISA (Thiel et al., 2003), a Perl script able to detect both perfect and compound microsatellites in nucleotide sequences. Compound microsatellites were defined as repeats interrupted by a nonrepetitive sequence of a maximum 50 nucleotides. MISA was set with the following minimum length criteria for the extraction of repeated units (unit size/minimum number of repeats): at least six dinucleotides (2/6), at least five trinucleotides (3/5), three tetranucleotides (4/3), three pentanucleotides (5/3), and three hexanucleotides (6/3). To reduce the errors caused by the parameter set, we reduced the necessary repetitions of the dinucleotide through pentanucleotide motifs, according to previous work conducted by Jung et al. (2005) and Poncet et al. (2006). Sequences containing corresponding repeat units were selected for marker development.

SSR primer design.

Primers for genic SSRs in the microsatellite sequences were designed using Primer3 (Rozen and Skaletsky, 2000) based on the following core criteria: a guanine-cytosine (GC) content between 40% and 60% with an optimum value of 50%; an annealing temperature between 54 and 63 °C; a minimum product length of 100 bp; and a primer length of 18 to 24 nucleotides. Product sizes ranged between 150 and 350 bp. Primers were synthesized by Shanghai Jierui Co. (Shanghai, P.R. China). The sequences for SSR primer design were shown in supplementary file.

PCR amplification and gel electrophoresis.

PCR amplification reactions were performed using a Biometra Authorized Thermal Cycler (An Analytik Jena Co., Thuringia, Germany) and conducted in a total volume of 30 μL containing 30 ng template DNA, 30 μmol each primer, 15 μL 2 × Taq mix, and double-distilled (dd) H2O to reach the total volume. PCR conditions were as follows: 94 °C for 5 min followed by 40 cycles of 94 °C for 30 s, 50 °C to 60 °C for 40 s, and 72 °C for 1 min and a final extension step at 72 °C for 10 min. To control the PCR product integrity, a 5-μL aliquot was visualized on a 1.5% agarose gel. The remaining reaction was run on a 6% polyacrylamide gel according to the specifications outlined in Li et al. (2013b) and then stained with 2% silver nitrate according to Bassam et al. (1991). The stained gels were photographed in white light.

Cross-species amplification.

To assess the transferability of our SSR markers, we tested their amplification in two other Rosaceae species: apple and pear. The PCR amplification reactions were performed like in the previously described protocols.

Fragment recovery and sequencing.

The target fragments obtained from the acrylamide gels were cut, washed twice in 1 mL ddH2O, and recovered according to Li et al. (2013b). The PCR conditions were performed as described previously, but only single-specific fragments detected on the agarose gels were cut. Further recovery was conducted using the DNA gel extraction kit produced by Shanghai Songon Biotech Co. (Shanghai, China), and sequencing was also conducted by Shanghai Songon Biotech Co.

Data collection and analysis.

The following parameters were estimated from the microsatellite marker data: number of alleles per locus: expected heterozygosity [He = 1 – Σpi2, where pi is the frequency of the ith allele (Nei, 1973)] and observed heterozygosity (Ho, calculated as the number of heterozygous genotypes divided by the total number of genotypes). According to the presence or absence of bands on the polyacrylamide gel, the same electrophoretic banding patterns were recorded as 1, whereas other patterns were recorded as 0. The polymorphism data were entered into Excel (Microsoft Inc., Redmond, WA) for cluster analysis using NYSYS-pc software (Rohlf, 2005), and a dendrogram was generated for the analysis of genetic relationships and diversity among the cultivars of loquat, apple, and pear. SSR loci recovered from the polyacrylamide gels were checked using SSRIT software (da Maia et al., 2008).


Distribution, frequency, and characteristics of SSR sequences.

In this study, MISA was used to identify SSR markers in the unique sequences. From the 63,608 sequences examined in the present study, representing a total size of 48,295,300 bp, 14,004 SSRs were identified in 10,511 sequences for a frequency of 22 SSR loci distributed over 100 unigenes. The distribution density represents one SSR locus for every 3.45 kb (kb/SSR). A total of 6754 sequences contained only one SSR, whereas 2544 sequences contained more than one SSR locus; 1213 SSR loci were present in compound formation. This result indicated that SSRs were quite abundant in the loquat transcriptome sequences (Table 2).

Table 2.

Total number and frequency distribution of each repeat type including mono, di-, tri, tetra-, penta-, and hexanucleotide in loquat.

Table 2.

The composition of SSRs was as follows: 2887 (20.62%) dinucleotides, 5896 (42.1%) trinucleotides, 2161 (15.43%) tetranucleotides, 622 (4.44%) pentanucleotides, and 850 (6.07%) hexanucleotides (Table 3). The most abundant motifs among the dinucleotides and trinucleotides were AG/CT and AAG/CTT with frequencies of 85.9% and 22.17%, respectively. The highest frequency tetranucleotide motif was AAAG/CTTT with a frequency of 13.98%. There were 93 kinds of pentanucleotide motif with AAAAG/CTTTT comprising 8.53%. The most predominant hexanucleotide motif was AGAGGG/CCCTCT (3.06%) followed by AAGAGG/CCTTCT (2.71%).

Table 3.

The number of major SSR motifs of di-, tri, tetra-, penta-, and hexanucleotide and their frequency in loquat.

Table 3.

Length distribution and location of SSR motifs.

The length of the microsatellite sequences ranged from 10 to 25 bases. Significant variation occurred in the length of the sequences, which deviated from the normal distribution. The most frequent microsatellite repeat length range was between 10 and 15 bp (Fig. 1), whereas the second most frequent range was between 13 and 16 bp. Only nine (0.06%) of the sequences were longer than 30 bp. A negative correlation existed between abundance, variation, rate and microsatellite length (Fig. 1). Moreover, most dinucleotide and hexanucleotide motifs were found in noncoding regions, whereas trinucleotide, tetranucleotide, and pentanucleotide motifs occurred more frequently in the coding regions.

Fig. 1.
Fig. 1.

Frequency distribution of simple sequence repeat (SSR) motif repeat size (loci length) in loquat. The x-axis indicates the length of SSRs motif. The y-axis indicates the number of SSRs with different lengths: (A) nucleotide repeats of different lengths, (B) dinucleotide repeats of different lengths, (C) trinucleotide repeats of different lengths, (D) tetranucleotide repeats of different lengths, (E) pentanucleotide repeats of different lengths, and (F) hexanucleotide repeats of different lengths.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 139, 5; 10.21273/JASHS.139.5.507

Identification and polymorphism analysis of SSR loci.

Of the 70 SSR primer pairs, 54 (77.1%) generated clear DNA banding patterns with the expected size, and 33 SSR primers amplified polymorphic PCR products (Table 4). Figure 2 shows representative polyacrylamide gels amplified with primer pairs 4297 and 8296, respectively. A total of 248 alleles were obtained from the accessions, representing an average of 7.5 alleles per SSR marker and 243 (97.9%) of them were polymorphic bands. The number of alleles obtained for each primer ranged between two and 17. The polymorphic information content ranged from 0.24 to 0.89 with an average of 0.52, indicating that the SSRs developed in this study had high discriminatory power. The Ho value (heterozygosity) ranged from 0.03 to 0.94 with an average of 0.55, and the He value (expected heterozygosity) ranged from 0.11 to 0.88 with an average of 0.59 (Table 4).

Table 4.

Details of 33 high polymorphism genic simple sequence repeat primer and statistical parameters including number of amplification bands, polymorphic bands, polymorphisms, polymorphism information content (PIC), hetereozygosity observed (Ho), and expected heterozygosity (He) values among loquat cultivars.

Table 4.
Fig. 2.
Fig. 2.

Representative polyacrylamide gel images of genic simple sequence repeat (SSR) marker amplified by primer pairs 4297 and 8296: Maker DL2000 (M), accession numbers of loquat (one to 13), accession numbers of pear (14 to 23), accession numbers of apple (24 to 33). Cultivar names are listed in Table 1. (A) Amplified result of primer 4297; (B) amplified result of primer 8296.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 139, 5; 10.21273/JASHS.139.5.507

Transferability of SSR markers.

To test the interspecific transferability of these SSR markers in apple and pear, which belong to the same subfamily (Maloideae) as loquat, PCR amplification was conducted in 10 apple and 10 pear cultivars. Clear DNA fingerprints were obtained from the PCR amplification of apple and pear DNA using the loquat SSR primers as seen in the polyacrylamide gels of the SSR bands amplified by the primer pairs 4297 and 8296 (Fig. 2). Of the primer pairs, 30 produced the anticipated SSR bands in apple and 29 in pear, representing transferability rates of ≈90.9% and 87.9%, respectively. A high level of marker polymorphism was observed in apple (66.7%), whereas a low rate was seen in pear (51.5%). This result indicated that the SSR primers derived from loquat had a high generality among Maloideae species.

Sequence characteristic of PCR products.

Polyacrylamide fragments from seven primer pairs (254, 267, 3842, 4181, 5855, 7028, and 8296) were selected for further sequence analysis. Analysis of the 43 fragments indicated that 37 (88%) were successfully recovered and sequenced, of which four fragments contained no repeat motif and 33 expressed SSR loci, representing a rate of 89.2% (Table 5). According to our sequencing results for real SSR loci, ≈12,490 SSR loci are found in the loquat unigenes, but the SSR motifs were only partly conserved between loquat, apple, and pear. The majority of SSR markers developed from transcription sequences in this study contained real SSR loci. More than 50% of the PCR products obtained from apple and pear had different sizes than were expected. Most of the repeat fragment motifs were different from those of the loquat cultivars. These observed differences may the result of genetic divergence among the species (Table 5). The results also showed that different cultivars can share the same allele: sample Nos. 7, 8, and 9 were amplified from the three loquat cultivars Gangbeihongsha, Changhong 3, and Tianzhong, respectively. Compared with the original sequences, the identity values were more than 90%. Moreover, for the primer pair 5855, six sequences were recovered from three loquat and three pear cultivars; all cultivars shared the same allele, but the identity was lower in pear. Interestingly, different fragment sizes could be amplified from the same cultivar that contained the same repeating unit. For example, Nos. 22 and 23, the fragments derived from primer 5855 in the pear cultivar Qingxiang, shared the same locus.

Table 5.

Characteristics of fragments including amplification primer, expected and actual repeat motif, product size, and homology with original sequence recovered from polyacrylamide gel of different loquat, apple, and pear cultivars.

Table 5.

Cluster analysis.

In this study, an analysis of the genetic diversity among the 33 cultivars of loquat, apple, and pear was conducted using the polymorphic alleles obtained from the developed SSR primer pairs. A clustering diagram showed that the coefficients ranged from 0.58 to 0.96, and three major groups were identified at a similarity index of 0.67 (Fig. 3), which was consistent with the presence of three different species. In addition, a greater genetic relationship was observed between apple and loquat than between loquat and pear. In the loquat group, 13 cultivars were clustered into three subgroups with a high similarity coefficient (0.88). The first and the third loquat subgroups contained white-fleshed cultivars, whereas eight red-fleshed cultivars were clustered into the second subgroup. In the apple group, cultivars with the same geographical distribution such as Huashuai and Huaguan were clustered together with a genetic similarity coefficient of 0.92. In the pear group, all 10 cultivars were clearly separated in Figure 3.

Fig. 3.
Fig. 3.

Dendrogram constructed from 33 cultivars including loquat, apple, pear using polymorphic genic simple sequence repeat (SSR) marker developed in this study. All the cultivars were obviously separated into three groups: cultivars on the top belonged to the loquat group (one to –13), cultivars in the middle belonged to the apple group (24 to 33), and cultivars at the bottom belonged to the pear group (14 to 23).

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 139, 5; 10.21273/JASHS.139.5.507


SSR marker frequency and distribution in loquat transcriptome.

Genetic SSR markers are widely applied in diversity analysis, plant cultivar identification, and the construction of genetic linkage maps in population studies (Li et al., 2010b). As sequencing technology has developed, deep transcriptome sequencing has become a good resource for the development of SSRs because of the enormous amount of generated sequence data (Zheng et al., 2013). Markers based on transcriptome sequences are useful for the detection of functional variation and gene-associated genetic analysis. Based on the 63,608 nonredundant unigene sequences used in this study, a total of 12,416 SSRs were identified, excluding mononucleotide repeat motifs. Approximately 19.52% of the transcriptomic sequences possess SSR loci, representing a greater proportion than those found in highbush blueberry [18.24% (Rowland et al., 2012)], field pea [Pisum sativum, 17% (Kaur et al., 2012)], tea [Camellia sinensis, 16.67% (Tan et al., 2013)], Citrus [13% (Luro et al., 2008)], Amorphophallus [11.8% (Zheng et al., 2013)], and Epimedium [3.67% (Zeng et al., 2010)]. Our results indicate that the number of SSRs was sufficiently large to identify markers. The distribution density in loquat was one SSR locus per 3.45 kb, which exceeded the distribution densities observed in rubber tree [Hevea brasiliensis, 0.28 kb (Li et al., 2012)], Cryptomeria [0.92 to 1.72 kb (Ueno et al., 2012)], and peach [3.2 kb (Wang et al., 2013)] but were lower than those of Epimedium [6.69 kb (Zeng et al., 2010)], sesame [Sesamum indicum, 4.08 kb (Zhang et al., 2012a)], and peanut [Arachis hypogaea, 6.22 kb (Zhang et al., 2012b)]. These differences of SSR density may depend on the minimum length of the SSR repeat motif.

According to a previous report by Zeng et al. (2010), the frequency of nucleotide repeats theoretically decreases with increasing length, and dinucleotide repeat motifs are the most frequent repeat type followed by trinucleotides, tetranucleotides, pentanucleotides, and hexanucleotides. However, in this study, trinucleotide repeats [5896 (42.1%)] were the most dominant SSRs in loquat followed by dinucleotides [2887 (20.62%)] and tetranucleotides [2161 (15.43%)]. Hexanucleotide and pentanucleotide repeat units comprised only 4.44% and 6.07% of the total, respectively (Table 2). This trend is consistent with the results reported for other plant species (Li et al., 2010b; Liang et al., 2009; Luro et al., 2008; Moccia et al., 2009). In addition, the most abundant dinucleotide and trinucleotide repeat motifs were AG/CT and AGG/CCT, respectively. Similar results have been found in other plant species (An et al., 2009; Jiang et al., 2013; Li et al., 2012; Triwitayakorn et al., 2011).

Because genic SSR markers belong to gene-rich genome regions, they can be exploited for use in the marker-assisted breeding of loquat. Therefore, the set of genic SSR markers developed in this study represents a promising genomic resource. In addition, the length variation of the SSR motifs in this study showed deviation from the normal distribution, which may be the result of the strong convergence of selection pressures. This hypothesis is consistent with the conclusions drawn from previous microsatellite studies on tea plant (Li et al., 2010a; Wang, 2011) and seabuckthorn [Hippophae rhamnoides (Jain et al., 2014)]. Furthermore, most dinucleotide and hexanucleotide motifs occurred more frequently in noncoding regions, whereas other motifs were found in the coding regions. This phenomenon was also observed in Cymbidium ensifolium (Li et al., 2013c).

Polymorphism and transferability of SSR markers.

As a result of the sequence conservation of transcribed regions of the genome, a significant portion of the genic SSR primer pairs designed from the transcriptome of a given species is expected to show a high degree of transferability in distantly related species (Moccia et al., 2009). The transferability of genic SSR markers over different taxonomic levels has been demonstrated previously (Bory et al., 2008; Zheng et al., 2013). In our study, SSR primer amplification of the target loquat genomic DNA was comparable to the 60% to 92.2% success rate found in previous studies (Cloutier et al., 2009; Dutta et al., 2011; Rowland et al., 2012; Wei et al., 2011; Zhang et al., 2011). A total of 33 polymorphic SSR markers were obtained, which was higher than the total in mei [Prunus mume (Li et al., 2010b) and significantly lower than that in Amorphophallus (Zheng et al., 2013). The transferability of EST-SSRs among different related genera has been reported in many crop plants (Luro et al., 2008; Wang et al., 2011). The high transferability rate of loquat markers to apple and pear indicate that species in the Maloideae may be more closely related than was previously believed. In this study, the markers from loquat had high transferability rates, 90.9% and 87.9% in apple and pear, respectively, which indicated that the different species in the Maloideae may be evolutionarily closely related; the homologous comparison results also confirmed this point.

Characteristics of recovered PCR products.

In this study, 37 polyacrylamide fragments representing seven primer pairs were successfully recovered, and 89.2% (Table 5) of them contained real SSR loci, which was higher than the results obtained in mei (73.08%) and loquat (80%) by Li et al. (2013b) and Shangguan et al. (2010, 2011). It is worthwhile to note that the size ranges of most of sequenced PCR products in apple and pear were different from those observed in loquat, and showing lower identity between this three species, these observed differences may reflect genetic divergence among the genera, which will provide representative information for understanding the characteristics of genetic evolution of the three comparative genomics and phylogenetic relationship among these three species.

Characteristic of assessment of genetic relationships among different species.

Until now, little research has considered the genetic evolution of and diversity among the three Rosaceae species of loquat, apple, and pear using SSR markers. In the loquat group, the similarity values ranged between 0.87 and 0.96, implying that loquat has a rich genetic diversity. It should be noted that ‘Zaozhong 6’, ‘Sengweizaosheng’, and ‘Jiefangzhong’ were clustered in the same subgroup as was consistent with a previous report by He et al. (2011). ‘Sengweizaosheng’ and ‘Zaozhong 6’ were grouped together with a high similarity coefficient of 0.96, which was consistent with the origin of ‘Zaozhong 6’ as a hybrid between ‘Jiefangzhong’ and ‘Senweizaosheng’. The similarity coefficients of apple ranged from 0.89 to 0.94, whereas those of pear ranged from 0.80 to 0.90. The cultivar classifications between apple and pear groups were generally consistent with the genetic background and original geographic distribution data. It is noteworthy that the cultivar Pingguoli in the pear group, which was introduced from Jilin province of China, had a lower coefficient than the others. These results also indicated that the loquat SSR markers were useful in the evaluation of genetic relationships between and within the Malus or Pyrus species.


To the best of our knowledge, this study represents the first development of SSR markers from RNA-seq in loquat. A total of 14,004 SSR loci was obtained and 70 primer pairs were successfully designed based on the transcriptome sequences, 33 of which were validated and showed high polymorphism in loquat. As a result of the conservation of genic sequences, these markers had a higher transferability across species, indicating higher than expected genetic similarities among apple, pear, and loquat. The developed SSR markers represent a valuable resource for conducting marker-assisted selection, linkage mapping, and germplasm characterization analysis in loquat.

Literature Cited

  • An, Z., Zhao, Y., Cheng, H., Li, W. & Huang, H. 2009 Development and application of EST-SSR markers in Hevea brasiliensis Muell. Arg Hereditas 31 311 319 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Bassam, B., Caetano-A, G. & Gresshoff, P.M. 1991 Fast and sensitive silver staining of DNA in polyacrylamide gels Anal. Biochem. 196 80 83

  • Bory, S., Da Silva, D., Risterucci, A.M., Grisoni, M., Besse, P. & Duval, M.F. 2008 Development of microsatellite markers in cultivated vanilla: Polymorphism and transferability to other vanilla species Sci. Hort. 115 420 425

    • Search Google Scholar
    • Export Citation
  • Bouck, A. & Vision, T. 2006 The molecular ecologist's guide to expressed sequence tags Mol. Ecol. 16 907 924

  • Chen, C., Bowman, K.D., Choi, Y.A., Dang, P.M., Rao, M.N., Huang, S., Soneji, J.R., McCollum, T.G. & Gmitter, F.G. Jr 2006 EST-SSR genetic maps for Citrus sinensis and Poncirus trifoliate Tree Genet. Genomes 112 1248 1257

    • Search Google Scholar
    • Export Citation
  • Cloutier, S., Niu, Z., Datla, R. & Duguid, S. 2009 Development and analysis of EST-SSRs for flax (Linum usitatissimum L.) Theor. Appl. Genet. 119 53 63

  • da Maia, L.C., Palmieri, D.A., de Souza, V.Q., Kopp, M.M., de Carvalho, F.I. & Costa de Oliveira, A. 2008 SSR Locator: Tool for simple sequence repeat discovery integrated with primer design and PCR simulation Intl. J. Plant Genomics 412696 1 9

    • Search Google Scholar
    • Export Citation
  • Dutta, S., Kumawat, G., Singh, B.P., Gupta, D.K., Singh, S., Dogra, V., Gaikwad, K., Sharma, T.R., Raje, R.S., Bandhopadhya, T.K., Datta, S., Singh, M.N., Bashasab, F., Kulwal, P., Wanjari, K.B., Varshney, R., Cook, D.R. & Singh, N.K. 2011 Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L.) Millspaugh] BMC Plant Biol. 11 17

    • Search Google Scholar
    • Export Citation
  • Fu, X., Kong, W., Peng, G., Zhou, J., Azam, M., Xu, C., Grierson, D. & Chen, K. 2012 Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits J. Expt. Bot. 63 341 354

    • Search Google Scholar
    • Export Citation
  • Gao, Z., Wu, J., Liu, Z., Wang, L., Ren, H. & Shu, Q. 2013 Rapid microsatellite development for tree peony and its implications BMC Genomics 14 886

  • Gisbert, A.D., Lo’pez-Capuz, I., Soriano, J.M., Lla’cer, G., Romero, C. & Badenes, M.L. 2009a Development of microsatellite markers from loquat [Eriobotrya japonica (Thunb.) Lindl.] Mol. Ecol. Res. 9 803 805

    • Search Google Scholar
    • Export Citation
  • Gisbert, A.D., Martínez-Calvo, J., Lla’cer, G., Badenes, M.L. & Romero, C. 2009b Development of two loquat [Eriobotrya japonica (Thunb.) Lindl.] linkage maps based on AFLPs and SSR markers from different Rosaceae species Mol. Breed. 23 523 538

    • Search Google Scholar
    • Export Citation
  • Gutiérrez, O.A., Robinson, A.F., Jenkins, J.N., McCarty, J.C., Wubben, M.J., Callahan, F.E. & Nichols, R.L. 2011 Identification of QTL regions and SSR markers associated with resistance to reniform nematode in Gossypium barbadense L. accession GB713 Theor. Appl. Genet. 122 271 280

    • Search Google Scholar
    • Export Citation
  • He, Q., Li, X., Liang, G., Ji, K., Guo, Q., Yuan, W., Zhou, G., Chen, K., van de Weg, W. & Gao, Z. 2011 Genetic diversity and identity of Chinese loquat cultivars/accessions (Eriobotrya japonica) using apple SSR markers Plant Mol. Biol. Rpt. 29 197 208

    • Search Google Scholar
    • Export Citation
  • Jain, A., Chaudhary, S. & Prakash, C.S. 2014 Mining of microsatellites using next generation sequencing of seabuckthorn (Hippophae rhamnoides L.) transcriptome Physiol. Mol. Biol. Plants 20 115 123

    • Search Google Scholar
    • Export Citation
  • Jiang, B., Xie, D.S., Liu, W.R., Peng, Q.W. & He, X.M. 2013 De novo assembly and characterization of the transcriptome, and development of SSR markers in wax gourd (Benicasa hispida) PLoS One 8 e71054

    • Search Google Scholar
    • Export Citation
  • Jung, S., Abbot, T.A., Jesudu, R.C., Tomkins, J. & Main, D. 2005 Frequency, type, distribution and annotation of simple sequence repeats in Rosaceae ESTs Funct. Integr. Genomics 5 136 143

    • Search Google Scholar
    • Export Citation
  • Kaur, S., Pembleton, L.W., Cogan, N.O., Savin, K.W., Leonforte, T., Paull, J., Materne, M. & Forster, J.W. 2012 Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers BMC Genomics 13 104

    • Search Google Scholar
    • Export Citation
  • Li, C.Q., Wang, Y., Huang, X.M., Li, J., Wang, H.C. & Li, J.G. 2013a De novo assembly and characterization of fruit transcriptome in Litchi chinensis Sonn and analysis of differentially regulated genes in fruit in response to shading BMC Genomics 14 552

    • Search Google Scholar
    • Export Citation
  • Li, X., Xu, H. & Chen, J. 2013b Genetic diversity and relationships among 47 loquat cultivars revealed by EST-SSR markers Sci. Hort. 160 375 382

  • Li, X., Luo, J., Yan, T., Xiang, L., Jin, F., Sun, C. & Xie, M. 2013c Deep sequencing-based analysis of the Cymbidium ensifolium floral transcriptome PLoS One 8 e85480

    • Search Google Scholar
    • Export Citation
  • Li, X., Xiang, L., Luo, J., Hu, B., Tian, S., Xie, M. & Sunday, C. 2013d The strategy of RNA-seq, application and development of molecular marker derived from RNA-seq Chinese J. Cell Biol. 35 1 8 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Li, D., Deng, Z., Qin, B., Liu, X. & Men, Z. 2012 De novo assembly and characterization of bark transcriptome using illumina sequencing and development of EST-SSR markers in rubber tree (Hevea brasiliensis Muell. Arg.) BMC Genomics 13 192

    • Search Google Scholar
    • Export Citation
  • Li, S.X., Zhan, X.Y., Wang, Y.Y. & Yin, T.M. 2010a Content and characteristics of microsatellites detected in expressed sequence tag sequences in Eucalyptus Chinese Bul. Bot. 45 363 371 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Li, X., Shangguan, L., Song, C., Wang, C., Gao, Z. & Fang, J. 2010b Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers BMC Genet. 11 66

    • Search Google Scholar
    • Export Citation
  • Liang, X., Chen, X., Hong, Y., Liu, H., Zhou, G., Li, S. & Guo, B. 2009 Utility of EST derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachis wild species BMC Plant Biol. 9 35

    • Search Google Scholar
    • Export Citation
  • Lin, S.Q., Yang, X.H., Liu, C.M., Hu, Y.L., He, Y.H., Hu, G.B., Zhang, H.L., He, X. & Liu, Y.X. 2004 Natural geographical distribution of genus Eriobotrya plants in China Acta Hort. Sinica 31 569 573 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Luro, F.L., Costantino, G., Terol, J., Argout, X., Allario, T., Wincker, P., Talon, M., Ollitrault, P. & Morillon, R. 2008 Transferability of the EST-SSRs developed on Nules clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mapping BMC Genomics 9 287

    • Search Google Scholar
    • Export Citation
  • Mardis, E.R. 2008 The impact of next-generation sequencing technology on genetics Trends Genet. 24 133 141

  • Moccia, M., Oger-Desfeux, C., Marais, G. & Widmer, A. 2009 A white campion (Silene latifolia) floral expressed sequence tag (EST) library: Annotation, EST-SSR characterization, transferability, and utility for comparative mapping BMC Genomics 10 243

    • Search Google Scholar
    • Export Citation
  • Nei, M. 1973 Analysis of gene diversity in subdivided populations Proc. Natl. Acad. Sci. USA 70 3321 3323

  • Ono, N.N., Britton, M.T., Fass, J.N., Nicolet, C.M., Lin, D.W. & Tian, L. 2011 Exploring the transcriptome landscape of pomegranate fruit peel for natural product biosynthetic gene and SSR marker discovery J. Integr. Plant Biol. 53 800 813

    • Search Google Scholar
    • Export Citation
  • Pazos-Navarro, M., Dabauza, M., Correal, E., Hanson, K., Teakle, N., Real, N., Real, D. & Nelson, M.N. 2011 Next generation DNA sequencing technology delivers valuable genetic markers for the genomic orphan legume species, Bituminaria bituminosa BMC Genet. 12 104

    • Search Google Scholar
    • Export Citation
  • Poncet, V., Rondeau, M., Tranchant, C., Cayrel, A., Hamon, S., Dekochko, A. & Hamon, P. 2006 SSR mining in coffee tree EST databases: Potential use of EST-SSRs as markers for the Coffea genus Mol. Genet. Genomics 276 436 449

    • Search Google Scholar
    • Export Citation
  • Qiu, W.L. & Zhang, H.Z. 1996 China fruit records—Longan and loquat. China Forestry Press, Beijing, China. p. 91–239 [in Chinese]

  • Ramchiary, N., Nguyen, V.D., Li, X., Hong, C.P., Dhandapani, V., Choi, S.R., Yu, G., Piao, Z. & Lim, Y. 2011 Genic microsatellite markers in Brassica rapa: Development, characterization, mapping, and their utility in other cultivated and wild Brassica relatives DNA Res. 18 305 320

    • Search Google Scholar
    • Export Citation
  • Rohlf, F. 2005NTSYS-pc, Numerical taxonomy and multivariate analysis system. Version 2.2. Exeter Publ., Setauket, NY

  • Rowland, L.J., Alkharouf, N., Darwish, O., Ogden, E.L., Polashock, J.J., Bassil, N.V. & Main, D. 2012 Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation BMC Plant Biol. 12 46

    • Search Google Scholar
    • Export Citation
  • Rozen, S. & Skaletsky, H.J. 2000 Primer3 on the www for general users and for biologist programmers, p. 365–386. In: Krawetz, S. and S. Misener (eds.). Bioinformatics methods and protocols: Methods in molecular biology. Humana Press, Totowa, NJ

  • Shangguan, L., Li, X., Ning, N., Wang, Y., Zhang, Z. & Fang, J. 2011 Development of EST-SSR markers in apricot Acta Hort. Sinica 38 43 54 [in Chinese]

  • Shangguan, L., Li, X., Song, C., Wang, X., Wang, Y., Zhang, Z. & Fang, J. 2010 Development of EST-SSR markers in Prunus mune and its application. Acta Bot Boreali-Occidentalia Sinica 30 1766 1772 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Tan, L.Q., Wang, L.Y., Wei, K., Zhang, C.C., Wu, L.Y., Qi, G.N., Cheng, H., Zhang, Q., Cui, Q.M. & Liang, J.B. 2013 Floral transcriptome sequencing for SSR marker development and linkage map construction in the tea plant (Camellia sinensis) PLoS One 8 e81611

    • Search Google Scholar
    • Export Citation
  • Temnykh, S., DeClerk, G., Lukashova, A., Lipovich, L., Cartinhour, S. & McCouch, S. 2001 Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential Genome Res. 11 1441 1452

    • Search Google Scholar
    • Export Citation
  • Thiel, T., Michalek, W., Varshney, R.K. & Graner, A. 2003 Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theor. Appl. Genet. 106 411 422

    • Search Google Scholar
    • Export Citation
  • Triwitayakorn, K., Chatkulkawin, P., Kanjanawattanawong, S., Sraphet, S., Yoocha, T., Sangsrakru, D., Chanprasert, J., Ngamphiw, C., Jomchai, N., Therawattanasuk, K. & Tangphatsornruang, S. 2011 Transcriptome sequencing of Hevea brasiliensis for development of microsatellite markers and construction of a genetic linkage map DNA Res. 18 471 482

    • Search Google Scholar
    • Export Citation
  • Ueno, S., Moriguchi, Y., Uchiyama, K., Ujino-Ihara, T., Futamura, N., Sakurai, T., Shinohara, K. & Tsumura, Y. 2012 A second generation framework for the analysis of microsatellites in expressed sequence tags and the development of EST-SSR markers for a conifer, Cryptomeria japonica BMC Genomics 13 136

    • Search Google Scholar
    • Export Citation
  • Wang, L., Zhao, S., Gu, C., Zhou, Y., Zhou, H., Ma, J., Cheng, J. & Han, Y. 2013 Deep RNA-Seq uncovers the peach transcriptome landscape Plant Mol. Biol. 83 365 377

  • Wang, L.Y. 2011 Mining and application of molecular markers from EST database and transcriptome sequencing in tea plant. Chinese Acad. Agr. Sci. Press, Beijing, China

  • Wang, Y.J., Li, X.Y., Han, J., Fang, W.M., Li, X.D., Wang, S.S. & Fang, J.G. 2011 Analysis of genetic relationships and identification of flowering-mei cultivars using EST-SSR markers developed from apricot and fruiting-mei Sci. Hort. 132 12 17

    • Search Google Scholar
    • Export Citation
  • Wei, W., Qi, X., Wang, L., Zhang, Y., Hua, W., Li, D., Lv, H. & Zhang, X. 2011 Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired-end sequencing and development of EST-SSR markers BMC Genomics 12 451

    • Search Google Scholar
    • Export Citation
  • Yue, X.Y., Liu, G.Q., Zong, Y., Teng, Y.W. & Cai, D.Y. 2014 Development of genic SSR markers from transcriptome sequencing of pear buds J. Zhejiang Univ. Sci. 15 303 312

    • Search Google Scholar
    • Export Citation
  • Zeng, S., Xiao, G., Guo, J., Fei, Z., Xu, Y., Roe, B.A. & Wang, Y. 2010 Development of a EST dataset and characterization of EST-SSRs in a traditional Chinese medicinal plant, Epimedium sagittatum (Sieb. Et Zucc.) Maxim BMC Genomics 11 94

    • Search Google Scholar
    • Export Citation
  • Zhang, H., Wei, L., Miao, H., Zhang, T. & Wang, C. 2012a Development and validation of genic-SSR markers in sesame by RNA-seq BMC Genomics 13 316

  • Zhang, J., Liang, S., Duan, J., Wang, J., Chen, S., Cheng, Z., Zhang, Q., Liang, X. & Li, Y. 2012b De novo assembly and characterisation of the transcriptome during seed development, and generation of genic-SSR markers in peanut (Arachis hypogaea L.) BMC Genomics 13 90

    • Search Google Scholar
    • Export Citation
  • Zhang, Y., Jun, L., Zhong, X., Li, F., Bo, P., Yu, J., Jing, Y.C. & Xiong, J.Z. 2011 Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas) BMC Plant Biol. 11 139

    • Search Google Scholar
    • Export Citation
  • Zheng, X., Pan, C., Diao, Y., You, Y., Yang, C. & Hu, Z. 2013 Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae) BMC Genomics 14 490

    • Search Google Scholar
    • Export Citation

Supplemental file

Seventy unigenes derived from loquat transcriptome used for genic SSR primer design in this study. The details in bold were listed in sequence of unigene code, motif type, repeat motif, repeat size, SSR start position, SSR end position; p2: dinueleotide repeats; p3: trinucleotide repeats; p4: tetranucleotide repeats; p5: pentanucleotide repeats; p6: hexanucleotide repeats. The nucleotides of the unigene sequences in pink were repeat motifs, and the ones in yellow were the position of the primers. The left and right primers and the product size designed by Primer 3 were listed below the unigene sequences.

1. G1_Unigene_BMK.62 p6 (AGCTGG)3 18 996 1013





2. G1_Unigene_BMK.64 p4 (TTCT)6 24974 997





3. G1_Unigene_BMK.101 p4 (TGAG)6 241863 1886





4. G1_Unigene_BMK.137 p3 (AGA)6 18 81 98





5. G1_Unigene_BMK.160 p3 (TCA)7 21 242 262








6. G1_Unigene_BMK.217 p6 (TCCTTC)3 18 94 111





7. G1_Unigene_BMK.254 p4 (CATG)5 20352 371





8. G1_Unigene_BMK.267 p4 (AACC)5 20205 224





9. G1_Unigene_BMK.328 p2 (GA)10 201997 2016





G1_Unigene_BMK.328 p2 (CT)10 20 2157 2176




10. G1_Unigene_BMK.407 p6 (CCCATC)4 24 56 79





G1_Unigene_BMK.407 p6 (CCAGCA)3 18476 493




11. G1_Unigene_BMK.436 p3 (TTG)6 18 1076 1093





12. G1_Unigene_BMK.458 p6 (GAATGG)3 18303 320





13. G1_Unigene_BMK.577 p3 (AGT)7 211911 1931





14. G1_Unigene_BMK.673 p6 (GGCACC)3 18342 359





15. G1_Unigene_BMK.683 p5 (ATCCA)4 20 771 790





16. G1_Unigene_BMK.704 p6 (TTTTGT)3 18 702 719





17. G1_Unigene_BMK.782 p6 (GGCGGT)3 18 417 434





18. G1_Unigene_BMK.949 p6 (AGGGCA)3 18 200 217





19. G1_Unigene_BMK.1448 p2 (AG)11 22 950 971





20. G1_Unigene_BMK.1461 p3 (TTG)7 21 2000 2020





21. G1_Unigene_BMK.1655 p6 (ATGGGA)3 18 722 739





22. G1_Unigene_BMK.1726 p4 (AAGC)5 20766 785





23. G1_Unigene_BMK.1812 p3 (CGT)6 18 1150 1167





24. G1_Unigene_BMK.2010 p3 (GCA)6 18783 800





25. G1_Unigene_BMK.2117 p6 (TGCTGA)3 18465 482





26. G1_Unigene_BMK.2121 p6 (GCTTGC)3 18506 523





27. G1_Unigene_BMK.2184 p3 (GAG)6 18 340 357





28. G1_Unigene_BMK.2519 p3 (GAG)6 18 228 245





29. G1_Unigene_BMK.2540 p3 (CGA)6 18 57 74





30. G1_Unigene_BMK.3842 p5 (TCGGT)3 15 515 529





31. G1_Unigene_BMK.4019 p5 (CCAAT)3 15 148 162





32. G1_Unigene_BMK.4067 p6 (CGGAGG)4 24 436 459





33. G1_Unigene_BMK.4181 p3 (TTC)6 18 358 375





34. G1_Unigene_BMK.4297 p6 (AGAGAA)3 18 101 118





35. G1_Unigene_BMK.4719 p3 (TCG)6 1899 116





36. G1_Unigene_BMK.5242 c (ACATCT)3(ACATCA)3 36 203 238





37. G1_Unigene_BMK.5607 p6 (AGGTCA)4 241349 1372





38. G1_Unigene_BMK.5644 p5 (GAGAC)4 20 1192 1211





39. G1_Unigene_BMK.5855 p5 (GAACA)4 20 140 159





40. G1_Unigene_BMK.6116 c (GGAATT)4ga(GATTGG)3 44 227 270





41. G1_Unigene_BMK.6539 c (GGT)6agtggttgactgccgccggagcaggaactttggccagcatttctactatctgtgtgtgaaattgtgatacaaagtgaaagtgcaagtc(GTTGGA)3 124 2256 2379





42. G1_Unigene_BMK.7028 p5 (TGATT)4 20 5877





43. G1_Unigene_BMK.7859 p6 (TCAAGA)4 24 1651 1674





44. G1_Unigene_BMK.7950 p5 (TTCAA)4 20496 515





45. G1_Unigene_BMK.7991 p3 (ACC)7 21243 263





46. G1_Unigene_BMK.8037 p3 (CTG)7 21 708 728





47. G1_Unigene_BMK.8106 c (CCACCT)3cctctttctcctcgtacacc(TCCTCG)3 56392 447





48. G1_Unigene_BMK.8119 p3 (AAT)6 18 97114





49. G1_Unigene_BMK.8296 p4 (CAAA)520 132 151





50. G1_Unigene_BMK.8884 p2 (AG)11 22739 760





51. G1_Unigene_BMK.8968 p6(ATTTCG)4 24163 186





52. G1_Unigene_BMK.8995 p2 (CT)10 2091 110





53. G1_Unigene_BMK.9351 c (CTCTTT)3gag(ACCTAC)3 39 435 473





54. G1_Unigene_BMK.9401 p6 (CCAAAC)4 24 126 149





55. G1_Unigene_BMK.9465 p6 (TTCTGG)4 24 488 511





56. G1_Unigene_BMK.9873 p5 (GAATT)4 20 500 519





57. G1_Unigene_BMK.11082 p4 (AAAT)5 20102 121





58. G1_Unigene_BMK.11093 p3 (CTC)7 21 1198 1218





59. G1_Unigene_BMK.11099 p5 (TAGAC)5 25 1831 1855





60. G1_Unigene_BMK.11165 p6 (AACCCT)3 181231 1248





61. G1_Unigene_BMK.11242 p6 (CTTCTG)4 24 2455 2478





62. G1_Unigene_BMK.11339 1 p6 (AGCCGG)3 18 542 559





63. G1_Unigene_BMK.11347 p3 (ATT)6 18711 728





64. G1_Unigene_BMK.11454 p3 (AGG)6 18 143 160





65. G1_Unigene_BMK.11485 p3 (CGT)6 18 2399 2416





66. G1_Unigene_BMK.11513 p3 (GGA)8 24 145 168





67. G1_Unigene_BMK.11522 p6 (ATGGCA)3 18 1018 1035





68. G1_Unigene_BMK.11609 p6 (TTTTTA)3 18 746 763





69. G1_Unigene_BMK.11759 p3 (GGA)7 21 1852 1872





70. G1_Unigene_BMK.11787 p5 (CCGAA)4 20 207 226





If the inline PDF is not rendering correctly, you can download the PDF file here.

Contributor Notes

We appreciate our funding from the China Postdoctoral Science Foundation (2013M531482); the Key Project for New Agricultural Cultivar Breeding in Zhejiang Province, China (2012C12904-5); the National Science Foundation for Distinguished Young Scholars of China (Grant No. 31101530); the Science and Technology Plan projects of Ningbo (2013C11022); and Science and Technology Innovation and Promotion Project (2014CX015).

Corresponding author. E-mail:

  • View in gallery

    Frequency distribution of simple sequence repeat (SSR) motif repeat size (loci length) in loquat. The x-axis indicates the length of SSRs motif. The y-axis indicates the number of SSRs with different lengths: (A) nucleotide repeats of different lengths, (B) dinucleotide repeats of different lengths, (C) trinucleotide repeats of different lengths, (D) tetranucleotide repeats of different lengths, (E) pentanucleotide repeats of different lengths, and (F) hexanucleotide repeats of different lengths.

  • View in gallery

    Representative polyacrylamide gel images of genic simple sequence repeat (SSR) marker amplified by primer pairs 4297 and 8296: Maker DL2000 (M), accession numbers of loquat (one to 13), accession numbers of pear (14 to 23), accession numbers of apple (24 to 33). Cultivar names are listed in Table 1. (A) Amplified result of primer 4297; (B) amplified result of primer 8296.

  • View in gallery

    Dendrogram constructed from 33 cultivars including loquat, apple, pear using polymorphic genic simple sequence repeat (SSR) marker developed in this study. All the cultivars were obviously separated into three groups: cultivars on the top belonged to the loquat group (one to –13), cultivars in the middle belonged to the apple group (24 to 33), and cultivars at the bottom belonged to the pear group (14 to 23).

  • An, Z., Zhao, Y., Cheng, H., Li, W. & Huang, H. 2009 Development and application of EST-SSR markers in Hevea brasiliensis Muell. Arg Hereditas 31 311 319 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Bassam, B., Caetano-A, G. & Gresshoff, P.M. 1991 Fast and sensitive silver staining of DNA in polyacrylamide gels Anal. Biochem. 196 80 83

  • Bory, S., Da Silva, D., Risterucci, A.M., Grisoni, M., Besse, P. & Duval, M.F. 2008 Development of microsatellite markers in cultivated vanilla: Polymorphism and transferability to other vanilla species Sci. Hort. 115 420 425

    • Search Google Scholar
    • Export Citation
  • Bouck, A. & Vision, T. 2006 The molecular ecologist's guide to expressed sequence tags Mol. Ecol. 16 907 924

  • Chen, C., Bowman, K.D., Choi, Y.A., Dang, P.M., Rao, M.N., Huang, S., Soneji, J.R., McCollum, T.G. & Gmitter, F.G. Jr 2006 EST-SSR genetic maps for Citrus sinensis and Poncirus trifoliate Tree Genet. Genomes 112 1248 1257

    • Search Google Scholar
    • Export Citation
  • Cloutier, S., Niu, Z., Datla, R. & Duguid, S. 2009 Development and analysis of EST-SSRs for flax (Linum usitatissimum L.) Theor. Appl. Genet. 119 53 63

  • da Maia, L.C., Palmieri, D.A., de Souza, V.Q., Kopp, M.M., de Carvalho, F.I. & Costa de Oliveira, A. 2008 SSR Locator: Tool for simple sequence repeat discovery integrated with primer design and PCR simulation Intl. J. Plant Genomics 412696 1 9

    • Search Google Scholar
    • Export Citation
  • Dutta, S., Kumawat, G., Singh, B.P., Gupta, D.K., Singh, S., Dogra, V., Gaikwad, K., Sharma, T.R., Raje, R.S., Bandhopadhya, T.K., Datta, S., Singh, M.N., Bashasab, F., Kulwal, P., Wanjari, K.B., Varshney, R., Cook, D.R. & Singh, N.K. 2011 Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L.) Millspaugh] BMC Plant Biol. 11 17

    • Search Google Scholar
    • Export Citation
  • Fu, X., Kong, W., Peng, G., Zhou, J., Azam, M., Xu, C., Grierson, D. & Chen, K. 2012 Plastid structure and carotenogenic gene expression in red- and white-fleshed loquat (Eriobotrya japonica) fruits J. Expt. Bot. 63 341 354

    • Search Google Scholar
    • Export Citation
  • Gao, Z., Wu, J., Liu, Z., Wang, L., Ren, H. & Shu, Q. 2013 Rapid microsatellite development for tree peony and its implications BMC Genomics 14 886

  • Gisbert, A.D., Lo’pez-Capuz, I., Soriano, J.M., Lla’cer, G., Romero, C. & Badenes, M.L. 2009a Development of microsatellite markers from loquat [Eriobotrya japonica (Thunb.) Lindl.] Mol. Ecol. Res. 9 803 805

    • Search Google Scholar
    • Export Citation
  • Gisbert, A.D., Martínez-Calvo, J., Lla’cer, G., Badenes, M.L. & Romero, C. 2009b Development of two loquat [Eriobotrya japonica (Thunb.) Lindl.] linkage maps based on AFLPs and SSR markers from different Rosaceae species Mol. Breed. 23 523 538

    • Search Google Scholar
    • Export Citation
  • Gutiérrez, O.A., Robinson, A.F., Jenkins, J.N., McCarty, J.C., Wubben, M.J., Callahan, F.E. & Nichols, R.L. 2011 Identification of QTL regions and SSR markers associated with resistance to reniform nematode in Gossypium barbadense L. accession GB713 Theor. Appl. Genet. 122 271 280

    • Search Google Scholar
    • Export Citation
  • He, Q., Li, X., Liang, G., Ji, K., Guo, Q., Yuan, W., Zhou, G., Chen, K., van de Weg, W. & Gao, Z. 2011 Genetic diversity and identity of Chinese loquat cultivars/accessions (Eriobotrya japonica) using apple SSR markers Plant Mol. Biol. Rpt. 29 197 208

    • Search Google Scholar
    • Export Citation
  • Jain, A., Chaudhary, S. & Prakash, C.S. 2014 Mining of microsatellites using next generation sequencing of seabuckthorn (Hippophae rhamnoides L.) transcriptome Physiol. Mol. Biol. Plants 20 115 123

    • Search Google Scholar
    • Export Citation
  • Jiang, B., Xie, D.S., Liu, W.R., Peng, Q.W. & He, X.M. 2013 De novo assembly and characterization of the transcriptome, and development of SSR markers in wax gourd (Benicasa hispida) PLoS One 8 e71054

    • Search Google Scholar
    • Export Citation
  • Jung, S., Abbot, T.A., Jesudu, R.C., Tomkins, J. & Main, D. 2005 Frequency, type, distribution and annotation of simple sequence repeats in Rosaceae ESTs Funct. Integr. Genomics 5 136 143

    • Search Google Scholar
    • Export Citation
  • Kaur, S., Pembleton, L.W., Cogan, N.O., Savin, K.W., Leonforte, T., Paull, J., Materne, M. & Forster, J.W. 2012 Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers BMC Genomics 13 104

    • Search Google Scholar
    • Export Citation
  • Li, C.Q., Wang, Y., Huang, X.M., Li, J., Wang, H.C. & Li, J.G. 2013a De novo assembly and characterization of fruit transcriptome in Litchi chinensis Sonn and analysis of differentially regulated genes in fruit in response to shading BMC Genomics 14 552

    • Search Google Scholar
    • Export Citation
  • Li, X., Xu, H. & Chen, J. 2013b Genetic diversity and relationships among 47 loquat cultivars revealed by EST-SSR markers Sci. Hort. 160 375 382

  • Li, X., Luo, J., Yan, T., Xiang, L., Jin, F., Sun, C. & Xie, M. 2013c Deep sequencing-based analysis of the Cymbidium ensifolium floral transcriptome PLoS One 8 e85480

    • Search Google Scholar
    • Export Citation
  • Li, X., Xiang, L., Luo, J., Hu, B., Tian, S., Xie, M. & Sunday, C. 2013d The strategy of RNA-seq, application and development of molecular marker derived from RNA-seq Chinese J. Cell Biol. 35 1 8 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Li, D., Deng, Z., Qin, B., Liu, X. & Men, Z. 2012 De novo assembly and characterization of bark transcriptome using illumina sequencing and development of EST-SSR markers in rubber tree (Hevea brasiliensis Muell. Arg.) BMC Genomics 13 192

    • Search Google Scholar
    • Export Citation
  • Li, S.X., Zhan, X.Y., Wang, Y.Y. & Yin, T.M. 2010a Content and characteristics of microsatellites detected in expressed sequence tag sequences in Eucalyptus Chinese Bul. Bot. 45 363 371 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Li, X., Shangguan, L., Song, C., Wang, C., Gao, Z. & Fang, J. 2010b Analysis of expressed sequence tags from Prunus mume flower and fruit and development of simple sequence repeat markers BMC Genet. 11 66

    • Search Google Scholar
    • Export Citation
  • Liang, X., Chen, X., Hong, Y., Liu, H., Zhou, G., Li, S. & Guo, B. 2009 Utility of EST derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachis wild species BMC Plant Biol. 9 35

    • Search Google Scholar
    • Export Citation
  • Lin, S.Q., Yang, X.H., Liu, C.M., Hu, Y.L., He, Y.H., Hu, G.B., Zhang, H.L., He, X. & Liu, Y.X. 2004 Natural geographical distribution of genus Eriobotrya plants in China Acta Hort. Sinica 31 569 573 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Luro, F.L., Costantino, G., Terol, J., Argout, X., Allario, T., Wincker, P., Talon, M., Ollitrault, P. & Morillon, R. 2008 Transferability of the EST-SSRs developed on Nules clementine (Citrus clementina Hort ex Tan) to other Citrus species and their effectiveness for genetic mapping BMC Genomics 9 287

    • Search Google Scholar
    • Export Citation
  • Mardis, E.R. 2008 The impact of next-generation sequencing technology on genetics Trends Genet. 24 133 141

  • Moccia, M., Oger-Desfeux, C., Marais, G. & Widmer, A. 2009 A white campion (Silene latifolia) floral expressed sequence tag (EST) library: Annotation, EST-SSR characterization, transferability, and utility for comparative mapping BMC Genomics 10 243

    • Search Google Scholar
    • Export Citation
  • Nei, M. 1973 Analysis of gene diversity in subdivided populations Proc. Natl. Acad. Sci. USA 70 3321 3323

  • Ono, N.N., Britton, M.T., Fass, J.N., Nicolet, C.M., Lin, D.W. & Tian, L. 2011 Exploring the transcriptome landscape of pomegranate fruit peel for natural product biosynthetic gene and SSR marker discovery J. Integr. Plant Biol. 53 800 813

    • Search Google Scholar
    • Export Citation
  • Pazos-Navarro, M., Dabauza, M., Correal, E., Hanson, K., Teakle, N., Real, N., Real, D. & Nelson, M.N. 2011 Next generation DNA sequencing technology delivers valuable genetic markers for the genomic orphan legume species, Bituminaria bituminosa BMC Genet. 12 104

    • Search Google Scholar
    • Export Citation
  • Poncet, V., Rondeau, M., Tranchant, C., Cayrel, A., Hamon, S., Dekochko, A. & Hamon, P. 2006 SSR mining in coffee tree EST databases: Potential use of EST-SSRs as markers for the Coffea genus Mol. Genet. Genomics 276 436 449

    • Search Google Scholar
    • Export Citation
  • Qiu, W.L. & Zhang, H.Z. 1996 China fruit records—Longan and loquat. China Forestry Press, Beijing, China. p. 91–239 [in Chinese]

  • Ramchiary, N., Nguyen, V.D., Li, X., Hong, C.P., Dhandapani, V., Choi, S.R., Yu, G., Piao, Z. & Lim, Y. 2011 Genic microsatellite markers in Brassica rapa: Development, characterization, mapping, and their utility in other cultivated and wild Brassica relatives DNA Res. 18 305 320

    • Search Google Scholar
    • Export Citation
  • Rohlf, F. 2005NTSYS-pc, Numerical taxonomy and multivariate analysis system. Version 2.2. Exeter Publ., Setauket, NY

  • Rowland, L.J., Alkharouf, N., Darwish, O., Ogden, E.L., Polashock, J.J., Bassil, N.V. & Main, D. 2012 Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation BMC Plant Biol. 12 46

    • Search Google Scholar
    • Export Citation
  • Rozen, S. & Skaletsky, H.J. 2000 Primer3 on the www for general users and for biologist programmers, p. 365–386. In: Krawetz, S. and S. Misener (eds.). Bioinformatics methods and protocols: Methods in molecular biology. Humana Press, Totowa, NJ

  • Shangguan, L., Li, X., Ning, N., Wang, Y., Zhang, Z. & Fang, J. 2011 Development of EST-SSR markers in apricot Acta Hort. Sinica 38 43 54 [in Chinese]

  • Shangguan, L., Li, X., Song, C., Wang, X., Wang, Y., Zhang, Z. & Fang, J. 2010 Development of EST-SSR markers in Prunus mune and its application. Acta Bot Boreali-Occidentalia Sinica 30 1766 1772 [in Chinese]

    • Search Google Scholar
    • Export Citation
  • Tan, L.Q., Wang, L.Y., Wei, K., Zhang, C.C., Wu, L.Y., Qi, G.N., Cheng, H., Zhang, Q., Cui, Q.M. & Liang, J.B. 2013 Floral transcriptome sequencing for SSR marker development and linkage map construction in the tea plant (Camellia sinensis) PLoS One 8 e81611

    • Search Google Scholar
    • Export Citation
  • Temnykh, S., DeClerk, G., Lukashova, A., Lipovich, L., Cartinhour, S. & McCouch, S. 2001 Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential Genome Res. 11 1441 1452

    • Search Google Scholar
    • Export Citation
  • Thiel, T., Michalek, W., Varshney, R.K. & Graner, A. 2003 Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.) Theor. Appl. Genet. 106 411 422

    • Search Google Scholar
    • Export Citation
  • Triwitayakorn, K., Chatkulkawin, P., Kanjanawattanawong, S., Sraphet, S., Yoocha, T., Sangsrakru, D., Chanprasert, J., Ngamphiw, C., Jomchai, N., Therawattanasuk, K. & Tangphatsornruang, S. 2011 Transcriptome sequencing of Hevea brasiliensis for development of microsatellite markers and construction of a genetic linkage map DNA Res. 18 471 482

    • Search Google Scholar
    • Export Citation
  • Ueno, S., Moriguchi, Y., Uchiyama, K., Ujino-Ihara, T., Futamura, N., Sakurai, T., Shinohara, K. & Tsumura, Y. 2012 A second generation framework for the analysis of microsatellites in expressed sequence tags and the development of EST-SSR markers for a conifer, Cryptomeria japonica BMC Genomics 13 136

    • Search Google Scholar
    • Export Citation
  • Wang, L., Zhao, S., Gu, C., Zhou, Y., Zhou, H., Ma, J., Cheng, J. & Han, Y. 2013 Deep RNA-Seq uncovers the peach transcriptome landscape Plant Mol. Biol. 83 365 377

  • Wang, L.Y. 2011 Mining and application of molecular markers from EST database and transcriptome sequencing in tea plant. Chinese Acad. Agr. Sci. Press, Beijing, China

  • Wang, Y.J., Li, X.Y., Han, J., Fang, W.M., Li, X.D., Wang, S.S. & Fang, J.G. 2011 Analysis of genetic relationships and identification of flowering-mei cultivars using EST-SSR markers developed from apricot and fruiting-mei Sci. Hort. 132 12 17

    • Search Google Scholar
    • Export Citation
  • Wei, W., Qi, X., Wang, L., Zhang, Y., Hua, W., Li, D., Lv, H. & Zhang, X. 2011 Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired-end sequencing and development of EST-SSR markers BMC Genomics 12 451

    • Search Google Scholar
    • Export Citation
  • Yue, X.Y., Liu, G.Q., Zong, Y., Teng, Y.W. & Cai, D.Y. 2014 Development of genic SSR markers from transcriptome sequencing of pear buds J. Zhejiang Univ. Sci. 15 303 312

    • Search Google Scholar
    • Export Citation
  • Zeng, S., Xiao, G., Guo, J., Fei, Z., Xu, Y., Roe, B.A. & Wang, Y. 2010 Development of a EST dataset and characterization of EST-SSRs in a traditional Chinese medicinal plant, Epimedium sagittatum (Sieb. Et Zucc.) Maxim BMC Genomics 11 94

    • Search Google Scholar
    • Export Citation
  • Zhang, H., Wei, L., Miao, H., Zhang, T. & Wang, C. 2012a Development and validation of genic-SSR markers in sesame by RNA-seq BMC Genomics 13 316

  • Zhang, J., Liang, S., Duan, J., Wang, J., Chen, S., Cheng, Z., Zhang, Q., Liang, X. & Li, Y. 2012b De novo assembly and characterisation of the transcriptome during seed development, and generation of genic-SSR markers in peanut (Arachis hypogaea L.) BMC Genomics 13 90

    • Search Google Scholar
    • Export Citation
  • Zhang, Y., Jun, L., Zhong, X., Li, F., Bo, P., Yu, J., Jing, Y.C. & Xiong, J.Z. 2011 Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas) BMC Plant Biol. 11 139

    • Search Google Scholar
    • Export Citation
  • Zheng, X., Pan, C., Diao, Y., You, Y., Yang, C. & Hu, Z. 2013 Development of microsatellite markers by transcriptome sequencing in two species of Amorphophallus (Araceae) BMC Genomics 14 490

    • Search Google Scholar
    • Export Citation
All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 677 113 2
PDF Downloads 72 24 0