Ratio of Myc and Myb Transcription Factors Regulates Anthocyanin Production in Orchid Flowers

in Journal of the American Society for Horticultural Science
View More View Less
  • 1 USDA/ARS, U.S. National Arboretum, Floral and Nursery Plants Research Unit, 3501 New York Avenue, NE, Washington, DC 20002
  • | 2 USDA/ARS, U.S. National Arboretum, Floral and Nursery Plants Research Unit, 10300 Baltimore Avenue, Beltsville, MD 20705

Many studies have examined anthocyanin gene expression in colorless tissues by introducing anthocyanin regulatory genes of the MYC/R and MYB/C1 families. Expression of the two regulatory genes under the control of a strong promoter generally results in high anthocyanin accumulation. However, such approaches usually have a negative effect on growth and development of the recovered plants. In this study the author used two promoters of different strengths—a weak (Solanum tuberosum L. polyubiquitin Ubi3) and a strong (double 35S) promoter—and generated two sets of expression constructs with the Zea mays L. anthocyanin regulatory genes MycLc and MybC1. A transient expression system was developed using biolistic bombardment of white Phalaenopsis amabilis (L.) Blume flowers, which the authors confirmed to be anthocyanin regulatory gene mutants. Transient expression of different combinations of the four constructs would generate three different MycLc-to-MybC1 ratios (>1, 1, <1). The enhanced green florescent protein gene (EGFP) was cotransformed as an internal control with the two anthocyanin regulatory gene constructs. These results demonstrate that the ratio of the two transcription factors had a significant influence on the amount of anthocyanin produced. Anthocyanin accumulation occurred only when MybC1 was under the control of the 35S promoter, regardless of whether MycLC was driven by the 35S or Ubi3 promoter.

Abstract

Many studies have examined anthocyanin gene expression in colorless tissues by introducing anthocyanin regulatory genes of the MYC/R and MYB/C1 families. Expression of the two regulatory genes under the control of a strong promoter generally results in high anthocyanin accumulation. However, such approaches usually have a negative effect on growth and development of the recovered plants. In this study the author used two promoters of different strengths—a weak (Solanum tuberosum L. polyubiquitin Ubi3) and a strong (double 35S) promoter—and generated two sets of expression constructs with the Zea mays L. anthocyanin regulatory genes MycLc and MybC1. A transient expression system was developed using biolistic bombardment of white Phalaenopsis amabilis (L.) Blume flowers, which the authors confirmed to be anthocyanin regulatory gene mutants. Transient expression of different combinations of the four constructs would generate three different MycLc-to-MybC1 ratios (>1, 1, <1). The enhanced green florescent protein gene (EGFP) was cotransformed as an internal control with the two anthocyanin regulatory gene constructs. These results demonstrate that the ratio of the two transcription factors had a significant influence on the amount of anthocyanin produced. Anthocyanin accumulation occurred only when MybC1 was under the control of the 35S promoter, regardless of whether MycLC was driven by the 35S or Ubi3 promoter.

Novel coloration and patterns of coloration add aesthetic appeal to ornamental plants and therefore have great commercial value to the floral and nursery industries. The red, purple, and blue colors of vegetative and floral organs are the result of anthocyanins, the prominent pigments in higher plants. The biochemistry and genetics of the anthocyanin-generating flavonoid biosynthetic pathway have been extensively studied (Davies, 2000; Griesbach, 2005; Irani et al., 2003; Koes et al., 2005; Winkel-Shirley, 2001). Analysis of Zea mays anthocyanin mutants revealed two families of regulatory factors, one encoding an MYC-like transcription factor with a basic helix–loop–helix motif (R family) and the other encoding an R2R3 MYB-like transcription factor (C1 family). The two factors are direct regulators of the anthocyanin structural genes (Spelt et al., 2000). Tissue-specific expression of regulatory genes and the specific response of the cis-element of the downstream structural genes to the regulatory factors (Quattrocchio et al., 1993, 1998) dictate anthocyanin expression pattern and determine, to a large degree, the coloration (Griesbach, 2005). There is increasing evidence that a third transcription factor, WD40, is also involved in anthocyanin regulation (Grotewold et al., 2000; Lesnick and Chandler, 1998).

Both the Myc and Myb gene families contain members that have arisen by gene duplication (Hanson et al., 1996; Zhang et al., 2000). Structural gene regulation is defined by the diversity among the Myc and Myb alleles, each of which regulates expression in a different manner. For example MybRos from Antirrhinum majus L. increases the anthocyanin level in vegetative tissue when expressed in Petunia ×hybrida Vilm. and in floral tissue when expressed in Eustoma grandiflorum (L.) Cass. (Schwinn et al., 2001). In P. ×hybrida, the combination MycAn1/MybAn2 induces anthocyanin pigmentation in the flower limb, whereas the MycAn1/MybAn4 combination induces anthocyanin pigmentation in the anthers, and the MycAn1/MybPh4 combination induces vacuolar acidification (Quattrocchio et al., 2006).

The Myc and Myb regulatory genes have been isolated from many different species (Borevitz et al., 2000; Chandler et al., 1989; Cone et al., 1986; Dellaporta et al., 1988; Elomaa et al., 1998, 2003; Gong et al., 1999; Goodrich et al., 1992; Ludwig et al., 1989; Mathews et al., 2003; Nesi et al., 2000; Paz-Ares et al., 1986, 1987; Perrot and Cone, 1989; Quattrocchio et al., 1998, 1999; Radicella et al., 1991; Spelt et al., 2000; Tonelli et al., 1991). Zea mays MycLc (R family) and MybC1 (C1 family) are two of the alleles that are the most well studied. They have been expressed in a number of plant species (Bovy et al., 2002; Bradley et al., 1998; Goldsbrough et al., 1996; Lloyd et al., 1992; Quattrocchio et al., 1993) in which they either enhanced the amount of anthocyanin produced or activated de novo biosynthesis in unpigmented tissues. However, in the majority of those studies, both regulatory genes were under the control of the cauliflower mosaic virus 35S promoter, which resulted in deleterious effects on plant growth (Bradley et al., 1998; Goldsbrough et al., 1996). This effect could be the result of either high levels of anthocyanin induced by the increased expression of the two regulatory genes or pleiotropic effects resulting from the accumulation of high levels of the two transcription factors.

In a previous study (Griesbach and Klein, 1993) we developed a transient gene complementation system using biolistics to determine the genetic basis of flower color mutants. We demonstrated that the albescent phenotype of Phalaenopsis pulcherrima (Lindl.) J.J. Sm. forma albescea (Fowlie) E.A. Christenson was the result of a regulatory gene mutation. In the current study we investigated the effects of different regulatory gene levels on the complementation of the albescent phenotype of Phalaenopsis amabilis.

Materials and Methods

Plant material.

Several commercial white P. amabilis hybrids (Kerry's Bromeliad Nursery, Homestead, FL), P. stuartiana Rchb., and P. schilleriana Rchb. were used in this study. All plants were grown in commercial orchid greenhouses until flowering. Flowering plants were then held in the laboratory for the duration of the study.

Gene constructs.

Promoters, structural genes and terminators were either used directly as received or amplified by polymerase chain reaction (PCR) to create flanking restriction enzyme sites to facilitate subsequent cloning. Polymerase chain reactions were performed with the following primers (restriction sites in bold):

Ubi3 promoter primer sequence: forward 5′CCAAGCTTCCAAAGCACATACTTAT3′; reverse 5′-GGATCCTTCGCCTGGAGGAGAG-3′

Ocs-Mas super promoter primer sequence: forward 5′AAGCTTGGATCCCTGAAAGCGA -CG3′; reverse 5′CCGGTACCTAGAGTCGATTTGG3′

MycLc primer sequence: forward 5′GGATCCATCGAGTTGTTGTACTCTTCGC3′; reverse 5′GGTACCTCTAGAATGCTATGACTTTG3′

rbcS terminator primer sequence: forward 5′-GGTACCGCTTTCGTTCGTATCATCGG-3′; reverse 5′GAATTCGGATCGATTGATGCATGTTGTC3′

All PCR reactions were carried out using high-fidelity Vent Polymerase (New England Biolabs, Ipswich, MA) and amplified fragments were subcloned into pCR-BluntII-TOPO vector (Invitrogen, Carlsbad, CA). Amplified fragments were all verified by partial sequencing from both ends.

All the constructs were based on the pUC19 vector. Plasmid S-MycLc was a transcriptional fusion of the double 35S promoter and a 2.2-kb MycLc complementary DNA (cDNA) (Lloyd et al., 1992). Plasmid U-MycLc was identical to S-MycLc, except the 35S promoter was replaced with the 920-bp Solanum tuberosum Ubi3 promoter (Garbarino and Belknap, 1994). Plasmid S-MybC1 and U-MybC1 were identical to S-MycLc and U-MycLc, except that the structural gene of MycLc was replaced with the 2.1-kb MybC1 cDNA (Lloyd et al., 1992). The terminator for all four constructs was the ribulose bisphosphate carboxylase (rbcS) terminator from Pisum sativum L. The internal transformation control plasmid, SuproEGFP, contained the enhanced green fluorescence protein gene coding region fused to the Ocs-Mas super promoter (Ni et al., 1995) and the 35S terminator.

Particle bombardment.

Plasmid DNA was isolated using the HiSpeed Plasmid Midi Kit (Qiagen, Valencia, CA) and quantified using a Shimadzu spectrophotometer ultraviolet-240 (Shimadzu Corporation, Kyoto, Japan). Immediately before bombardment, healthy orchid petals were harvested from the plant and arranged on moist filter paper in the center of a 9-cm-diameter petri dish. Bombardment was carried out using a PDS-1000/He (Bio-Rad, Hercules, CA). For each shot, 50 ng pSuproEGFP and 500 ng each of MycLC and MybC1 constructs were coprecipitated (Griesbach and Klein, 1993) onto 0.5 mg of 1.0-μm-diameter gold particles (Bio-Rad). Each plate was shot once at a rupture pressure of 3.724 MPa with a vacuum pressure of 94.7 kPa. The distance between the bottom of the rupture disk and the lid of the microcarrier launch assembly was adjusted to 1 cm. The target holder was placed 9 cm below the stopping screen in the bombardment chamber. At least five petals were bombarded for each of the four plasmid construct combinations along with the pSuproEEGFP transformation control. The bombardments were repeated multiple times.

Transient expression assay.

Five to 7 d after particle bombardment, the entire area of bombardment was examined for enhanced green fluorescent protein (EGFP) and anthocyanin expression using a stereomicroscope (SMZ1500; Nikon Instruments, Mellville, NY) equipped with an epi-illumination intermediate tube (P-FLA fluorescence attachment; Nikon) and a fluorescence illuminator with a mercury arc lamp. An Endow EGFP 500 Long Pass filter set (Chroma Technology Corp., Rockingham, VT) was placed in the light path. The fluorescent images of the fields with clearly defined EGFP expression were captured at 1 s under 50× magnitude using a digital camera (DXM1200; Nikon) attached to the microscope. Anthocyanin accumulation was also viewed under visible light.

Anthocyanin and EGFP expression was quantitatively measured using WinCAM Pro 1 (Regent Instruments, Quebec, Canada). Color classes were selected to cover the range in the intensity of color resulting from anthocyanin and EGFP expression. The number of pixels of each color class was measured. Enhanced green fluorescent protein expression was used to standardize bombardments. Data were reported as the mean of the number of pixels of anthocyanin color divided by the number of pixels of EGFP color from images taken from five independent transformation events.

Results

Activation of de novo anthocyanin biosynthesis in white Phalaenopsis amabilis petals by transient expression of MycLc and MybC1.

To test whether the albescent phenotype of P. amabilis (Fig. 1A) could be complemented with regulatory gene expression, constructs S-MycLc and S-MybC1 were cointroduced into its white petals. Cells expressing MycLc and MybC1 were easily observed by the appearance of prominent reddish purple spots (Fig. 1B), characteristic of anthocyanin production (Griesbach and Klein, 1993). This result confirms that white P. amabilis can express anthocyanins if MycLc and MybC1 are present.

Fig. 1.
Fig. 1.

(A–C) Transactivation of anthocyanin synthesis in white Phalaenopsis amabilis petals after particle bombardment-mediated cotransformation of the S-MycLc and S-MybC1 constructs. (A) White P. amabilis flowers. (B) Anthocyanin accumulation viewed under white light. (C) Anthocyanin and enhanced green fluorescent protein accumulation viewed under near-ultraviolet light.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 133, 1; 10.21273/JASHS.133.1.133

We further tested whether both MycLc and MybC1 were required to induce anthocyanin biosynthesis. Phalaenopsis amabilis petals were bombarded singularly with either S-MycLc or S-MybC1. No reddish purple spots were observed, which indicated that both regulatory genes are required to activate anthocyanin biosynthesis in white P. amabilis petals.

Transient coexpression of anthocyanin and enhanced green fluorescent protein.

We noticed considerable variation in the number of transformed cells from one bombardment to another. It is well-known that not all transformation experiments will have the same efficiency because of variation in factors such as DNA coating (Sanford et al., 1993). Without an internal transformation control, it would not be possible to determine whether the difference in anthocyanin expression was the result of variations in transformation efficiency or actual differences in regulatory gene expression. To ensure a more accurate comparison, we selected EGFP as the internal control for the biolistic process. Under near-ultraviolet light, EGFP appears as green fluorescence in the cytoplasm, and anthocyanin appears as orange fluorescence within the vacuole (Fig. 2). By comparing anthocyanin expression with EGFP expression, differences in gene expressions that were the result of fluctuations in transformation efficiency were minimized.

Fig. 2.
Fig. 2.

Simultaneous detection of coexpression of enhanced green fluorescent protein (green, cytoplasm and nucleus) and anthocyanin (orange-red, vacuole) in the cells of white Phalaenopsis amabilis petals under near-ultraviolet light.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 133, 1; 10.21273/JASHS.133.1.133

Because cotransformation frequencies are usually about 75% to 90% (Lee et al., 2002; Schocher et al., 1986; Yepes et al., 1995), we can assume that most of the cells expressing the EGFP gene should also express the anthocyanin regulatory genes. In P. amabilis petals that were cobombarded with the EGFP and anthocyanin regulatory genes, the number of cells showing both EGFP (green fluorescence in the cytoplasm) and anthocyanin (orange fluorescence in the vacuole) expression was very high (compare Fig. 1B with Fig. 1C). Therefore when comparing gene expression within the different constructs, we were able to compare the ratio of the number of cells expressing EGFP with the number of cells expressing anthocyanin.

Degree of pigmentation correlated with the expression level of C1.

Both 35S and Ubi3 are constitutive promoters. Constitutive promoters often show different strengths in different tissues. In preliminary work, we examined the promoter strength of 35S and Ubi3 in P. amabilis petals using EGFP as the reporter gene. As expected, the 35S promoter was stronger than the Ubi3 promoter (Table 1). Because EGFP expression using the same promoter varied between bombardments, the se was high.

Table 1.

Anthocyanin and green fluorescent protein expression in bombarded Phalaenopsis pulcherima petals using different regulatory gene constructs.

Table 1.

It is reasonable to assume that different promoter strengths would produce different levels of the regulatory proteins and create different ratios of the two regulatory factors in transient expression. The constructs with high gene expression (S-MycLc and S-MybC1) used the double 35S promoter, whereas the constructs with low gene expression (U-MycLc and U-MybC1) used the Ubi3 promoter. Different combinations of the constructs resulted in MycLc-to-MybC1 ratios > 1 (S-MycLc + U-MybC1), < 1 (U-MycLc + S-MybC1), and equal to 1 (S-MycLc + S-MybC1 and U-MycLc + U-MybC1). Together with the internal control SuproEGFP construct, these combinations were delivered into white P. amabilis petals.

Both S-MycLc + S-MybC1 (Fig. 3A) and U-MycLc + S-MybC1 (Fig. 3B) combinations produced high levels of anthocyanin pigmentation, whereas S-MycLc + U-MybC1 (Fig. 3C) and U-MycLc + U-MybC1 (Fig. 3D) combinations produced little anthocyanin despite efficient expression of cotransformed EGFP control. It appears that low levels of the MybC1 protein (U-MybC1), even combined with high levels of MycLc (S-MycLc) resulted in little anthocyanin accumulation, whereas high levels of MybC1 (S-MybC1), together with the MycLc either at low (U-MycLc) or high (S-MycLc) levels, resulted in high anthocyanin production. At the high MybC1 level, there was no statistically significant difference in anthocyanin production between the low and high MycLc levels (Table 1). These data suggest that the amount of anthocyanin produced was positively affected by the MybC1 expression level. When MybC1 is under the control of the Ubi3 promoter, it is possible that an insufficient amount of MybC1 is produced to activate the entire anthocyanin pathway.

Fig. 3.
Fig. 3.

(A–D) Different anthocyanin accumulation levels in white Phalaenopsis amabilis petals from transient expression of the two regulatory genes under the control of different promoters. (A) S-MycLc + S-MybC1. (B) U-MycLc + S-MybC1. (C) S-MycLc + U-MybC1. (D) U-MycLc + U-MybC1.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 133, 1; 10.21273/JASHS.133.1.133

Pigmentation pattern.

The other Phalaenopsis Blume species, P. stuartiana, displays a striking color pattern of white petals covered with mauve spots (Fig. 4A). To determine whether the unpigmented sections on the petals could express anthocyanin, we delivered constructs S-MycLc and S-MybC1 into the petals of P. stuartiana. Anthocyanin accumulation in the white tissue areas was easily observed (Fig. 4B, 4C). In addition, P. stuartiana responded to the S-MycLc and S-MybC1 ratio in the same manner as P. amabilis (data not shown).

Fig. 4.
Fig. 4.

(A–C) Activation of anthocyanin production in the unpigmented areas of Phalaenopsis stuartiana petals after introduction of S-MycLc and S-MybC1 constructs. (A) Phalaenopsis stuartiana flower. Induced anthocyanin expression (arrows) was viewed under white light (B) and near-ultraviolet light (C). A cluster of wild-type anthocyanin-expressing red cells were seen at the bottom of images B and C.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 133, 1; 10.21273/JASHS.133.1.133

Discussion

Enhanced green fluorescent protein as an ideal control reporter gene for anthocyanin transient expression.

A system for standardizing and quantifying transient genetic complementation was developed using EGFP expression as an internal transformation control. Enhanced green fluorescent protein was selected as the control reporter for the following reasons: First, EGFP and anthocyanin are both nondestructive markers and, under near-ultraviolet light, can be visualized directly (Griesbach, 1990). Second, accumulation of EGFP and anthocyanin is spatially mutually exclusive, with EGFP expression in the cytoplasm and anthocyanin accumulation in the vacuole. Therefore, EGFP and anthocyanin can be detected simultaneously. Third, and last, EGFP expression and regulatory gene-induced accumulation of anthocyanin are cell autonomous (Bowen, 1992; Goodman et al., 2004; Ludwig et al., 1990), which makes it possible to quantify gene expression.

The role of C1 in conditioning the level of pigmentation.

Earlier studies have hypothesized that the role of MycLc is to determine the temporal and spatial expression of the pigments (Ludwig et al., 1989). Our results indicate that the degree of anthocyanin pigmentation correlates with the promoter strength, and therefore presumably the level of MybC1, suggesting that MybC1 plays a role in determining the level of pigmentation. Because the MYC protein has a short half-life (Brody, 1996), its level within the cell is dependent on its rate of transcription, or its promoter strength.

It has been demonstrated previously that MybC1 physically interacts with the MYC-like transcription factor (Grotewold et al., 2000). Domain swap experiments (Hernandez et al., 2004; Sainz et al., 1997) suggested that the MybC1 protein's DNA-binding domain exerts an inhibitory effect on its activation domain. Only when its MYC counterpart is present, does the inhibition become released and the anthocyanin pathway activated. Our results further suggest that MybC1 and MycLc are not required in equal amounts to effect transcription.

Endogenous anthocyanin regulatory gene expression.

In contrast to the study of Z. mays suspension cells (deMajnik et al., 1998), our results with Phalaenopsis indicate that when MycLc is at a lower level than that of MybC1, sufficient amounts of anthocyanin still could be produced, but not vice versa. This difference may suggest that the threshold requirement for the regulatory genes to activate anthocyanin production is different in different plants. The threshold level is likely the result of either endogenous MYC production or stability.

The explanation for our results might lie in the nature of individual transcription factors. Gene expression profiling on MycR/MybC1 transformants (Bruce et al., 2000) has shown upregulation as well as downregulation of cDNA transcripts corresponding to different genes. As expected, gene expression specific to the flavonoid pathway was increased. Those genes with expression that was inhibited included histone, tubulin, and ribosomal proteins. These genes are essential for basic cell function, which might explain the slow growth of transformed cells. The data suggest that MycR + MybC1 acted in both activator and repressor capacities.

Gill and Ptashne (1988) described a phenomenon called squelching, which is caused by high-level expression of a transcription factor that subsequently inhibits transcription of certain genes lacking the specific binding site of the transcription factor. Cis-element studies of the anthocyanin structural genes have revealed several critical regions essential for anthocyanin activation (Elomaa et al., 2003; Lesnick and Chandler, 1998; Sainz et al., 1997). The MYB-like transcription factor (C1) binds directly to one of the sites, but there is no evidence so far to show that the MYC-like transcription factor binds to DNA.

We developed an in vivo functional assay system to monitor efficiently the activity of MYC- and MYB-like regulatory factors through anthocyanin production. We showed that low-level expression of the MYC-like regulatory factor can still achieve significant activation of anthocyanin when MYB-like regulatory factor is sufficiently expressed.

The failure to restore anthocyanin production with MycLc and MybC1 alone, and the success in inducing anthocyanin production with both genes together suggests that P. amabilis either does not have Myc and Myb anthocyanin regulatory genes or has nonfunctional anthocyanin regulators. Preliminary experiments to test this hypothesis, using reverse transcription PCR (RT-PCR) to compare the expression of two anthocyanin regulatory genes between P. amabilis (anthocyanin free) and an anthocyanin-producing species (P. schilleriana), revealed that for Myc, not only is the expression level similar between P. schilleriana and P. amabilis, but the sequences of the Myc RT-PCR product derived from each of species was virtually identical (data not shown). On the other hand, RT-PCR produced multiple Myb products. The Myb that was expressed in P. schilleriana was not expressed in P. amabilis. A different Myb was expressed in P. amabilis. Further studies are underway to characterize Myb expression in both species to determine whether Myb is the key factor in anthocyanin production and its potential target gene(s). Knowledge gained in this study could benefit future studies aimed at creating viable plants with new flower or foliage color.

Literature Cited

  • Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A. & Lamb, C. 2000 Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis Plant Cell 12 2383 2394

    • Search Google Scholar
    • Export Citation
  • Bovy, A., de Vos, R., Kemper, M., Schijlen, E., Almenar Pertejo, M., Muir, S., Collins, G., Robinson, S., Verhoeyen, M., Hughes, S., Santos-Buelga, C. & van Tunen, A. 2002 High-flavonol tomatoes resulting from the heterologous expression of the maize transcription factor genes LC and C1 Plant Cell 14 2509 2526

    • Search Google Scholar
    • Export Citation
  • Bowen, B. 1992 Anthocyanin genes as visual markers in transformed maize tissues 163 175 Gallagher S. GUS protocols: Using the GUS gene as reporter of gene expression Academic Press London

    • Search Google Scholar
    • Export Citation
  • Bradley, J.M., Davies, K.M., Deroles, S.C., Bloor, S.J. & Lewis, D.H. 1998 The maize Lc regulatory gene up regulates the flavonoid biosynthetic pathway of petunia Plant J. 13 381 392

    • Search Google Scholar
    • Export Citation
  • Brody, T.B. 1996 The interactive fly: A cyberspace guide to Drosophila development and metazoan evolution 27 Apr. 2007 <http://www.sdbonline.org/fly/aimain/1aahome.htm>.

    • Search Google Scholar
    • Export Citation
  • Bruce, W., Folkerts, O., Garnaat, C., Crasta, O., Roth, B. & Bowen, B. 2000 Expression profiling of the maize flavonoid pathway genes controlled by estradiol-inducible transcription factors CRC and P Plant Cell 12 65 80

    • Search Google Scholar
    • Export Citation
  • Chandler, V.L., Radicella, J.P., Robbins, T.P., Chen, J. & Turks, D. 1989 Two regulatory genes of the maize anthocyanin pathway are homologous: Isolation of B-utilizing R genomic sequences Plant Cell 1 1175 1183

    • Search Google Scholar
    • Export Citation
  • Cone, K.C., Burr, F.A. & Burr, B. 1986 Molecular analysis of the maize anthocyanin regulatory locus C1 Proc. Natl. Acad. Sci. USA 83 9631 9635

  • Davies, K. 2000 Plant colour and fragrance 127 163 Verpoortre R. & Alfermann A. Metabolic engineering of plant secondary metabolism Kluwer Academic Publishers Dordrecht, The Netherlands

    • Search Google Scholar
    • Export Citation
  • Dellaporta, S.L., Greenblatt, I., Kermicle, J., Hicks, J. & Wessler, S. 1988 Molecular cloning of the R-nj gene by transposon tagging with Ac 263 282 Gustafson J. & Appels R. Chromosome structure and function: Impact of new concepts Plenum Press New York

    • Search Google Scholar
    • Export Citation
  • deMajnik, J., Tanner, G., Joseph, R., Larkin, P., Weinman, J., Djordjevic, M. & Rolfe, B. 1998 Transient expression of maize anthocyanin regulatory genes influences anthocyanin production in white clover and peas Austral. J. Plant Phys. 25 335 343

    • Search Google Scholar
    • Export Citation
  • Elomaa, P., Mehto, M., Kotilainen, M., Helariutta, Y., Nevalainen, L. & Teeri, T.H. 1998 A bHLH transcription factor mediates organ, region and flower type specific signals on dihydroflavonol-4-reductase (dfr) gene expression in the inflorescence of Gerbera hybrida (Asteraceae) Plant J. 16 93 99

    • Search Google Scholar
    • Export Citation
  • Elomaa, P., Uimari, A., Mehto, M., Albert, V.A., Laitinen, R.A.E. & Teeri, T.H. 2003 Activation of anthocyanin biosynthesis in Gerbera hybrida (Asteraceae) suggests conserved protein–protein and protein–promoter interactions between the anciently diverged monocots and eudicots Plant Physiol. 133 1831 1842

    • Search Google Scholar
    • Export Citation
  • Garbarino, J. & Belknap, W. 1994 Isolation of a ubiquitin-ribosomal protein gene (ubi3) from potato and expression of its promoter in transgenic plants Plant Mol. Biol. 24 119 127

    • Search Google Scholar
    • Export Citation
  • Gill, G. & Ptashne, M. 1988 Negative effect of the transcriptional activator GAL4 Nature 334 721 724

  • Goldsbrough, A.P., Tong, Y. & Yoder, J.I. 1996 Lc as a non-destructive visual reporter and transposition excision marker gone for tomato Plant J. 9 927 933

    • Search Google Scholar
    • Export Citation
  • Gong, Z.Z., Yamagishi, E., Yamazaki, M. & Saito, K. 1999 A constitutively expressed Myc-like gene involved in anthocyanin biosynthesis from Perilla frutescens: Molecular characterization, heterologous expression in transgenic plants, and transactivation in yeast cells Plant Mol. Biol. 41 33 44

    • Search Google Scholar
    • Export Citation
  • Goodman, C.D., Casati, P. & Walbot, V. 2004 A multidrug resistance-associated protein involved in anthocyanin transport in Zea mays Plant Cell 16 1812 1826

    • Search Google Scholar
    • Export Citation
  • Goodrich, J., Carpenter, R. & Coen, E. 1992 A common gene regulates pigmentation pattern in diverse plant species Cell 68 995 964

  • Griesbach, R. 1990 Flavonoid copigments and anthocyanin of Phalaenopsis schilleriana Lindleyana 5 231 234

  • Griesbach, R. 2005 Biochemistry and genetics of flower color Plant Breed. Rev. 25 89 114

  • Griesbach, R. & Klein, T. 1993 In situ genetic complementation of a flower color mutant in Doritis pulcherrima (Orchidaceae) Lindleyana 8 223 226

  • Grotewold, E., Sainz, M.B., Tagliani, L., Hernandez, J.M., Bowen, B. & Chandler, V.L. 2000 Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R Proc. Natl. Acad. Sci. USA 97 13579 13584

    • Search Google Scholar
    • Export Citation
  • Hanson, M.A., Gaut, B.S., Stec, A.O., Fuerstenberg, S.I., Goodman, M.M., Coe, E.H. & Doebley, J.F. 1996 Evolution of anthocyanin biosynthesis in maize kernels: The role of regulatory and enzymatic loci Genetics 143 1395 1407

    • Search Google Scholar
    • Export Citation
  • Hernandez, J.M., Heine, G.F., Irani, N.G., Feller, A., Kim, M.-G., Matulnik, T., Chandler, V.L. & Grotewold, E. 2004 Different mechanisms participate in the R-dependent activity of the R2R3 MYB transcription factor C1 J. Biol. Chem. 279 48205 48213

    • Search Google Scholar
    • Export Citation
  • Irani, N., Hernandez, J.M. & Grotewold, E. 2003 Regulation of anthocyanin pigmentation Recent Adv. Phytochem. 38 59 78

  • Koes, R., Verweij, W. & Quattrocchio, F. 2005 Flavonoids: A colorful model for the regulation and evolution of biochemical pathways Trends Plant Sci. 10 236 242

    • Search Google Scholar
    • Export Citation
  • Lee, M.H., Min, M.K., Lee, Y.J., Jin, J.B., Shin, D.H., Kim, D.H., Lee, K.-H. & Hwang, I. 2002 ADP-ribosylation factor 1 of Arabidopsis plays a critical role in intracellular trafficking and maintenance of endoplasmic reticulum morphology in Arabidopsis Plant Physiol. 129 1507 1520

    • Search Google Scholar
    • Export Citation
  • Lesnick, M.L. & Chandler, V.L. 1998 Activation of the maize anthocyanin gene a2 is mediated by an element conserved in many anthocyanin promoters Plant Physiol. 117 437 445

    • Search Google Scholar
    • Export Citation
  • Lloyd, A.M., Walbot, V. & Davis, R.W. 1992 Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and C1 Science 258 1773 1775

    • Search Google Scholar
    • Export Citation
  • Ludwig, S.R., Bowen, B., Beach, L. & Wessler, S.R. 1990 A regulatory gene as a novel visible marker for maize transformation Science 247 449 450

  • Ludwig, S.R., Habera, L.F., Dellaporta, S.L. & Wessler, S.R. 1989 Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region Proc. Natl. Acad. Sci. USA 86 7092 7096

    • Search Google Scholar
    • Export Citation
  • Mathews, H., Clendennen, S.K., Caldwell, C.G., Liu, X.L., Connors, K., Matheis, N., Schuster, D.K., Menasco, D.J., Wagoner, W., Lightner, J. & Wagner, D.R. 2003 Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport Plant Cell 15 1689 1703

    • Search Google Scholar
    • Export Citation
  • Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M. & Lepiniec, L. 2000 The TT8 gene encodes a basic helix–loop–helix domain protein required for expression of DFR and BAN genes in arabidopsis siliques Plant Cell 12 1863 1878

    • Search Google Scholar
    • Export Citation
  • Ni, M., Cui, D., Einstein, J., Narasimhulu, S., Vergara, C.E. & Gelvin, S.B. 1995 Strength and tissue specificity of chimeric promoters derived from the octopine and mannopine synthase genes Plant J. 7 661 676

    • Search Google Scholar
    • Export Citation
  • Paz-Ares, J., Ghosal, U., Wienand, U., Peterson, P. & Saedler, H. 1987 The regulatory c1 locus of Zea mays encodes a protein with homology to myb prto-oncogene products and with structural similarities to transcriptional activators EMBO J. 6 3553 3558

    • Search Google Scholar
    • Export Citation
  • Paz-Ares, J., Wienand, U., Peterson, P. & Saedler, H. 1986 Molecular cloning of the c locus of Zea mays: A locus regulating the anthocyanin pathway EMBO J. 5 829 833

    • Search Google Scholar
    • Export Citation
  • Perrot, G. & Cone, K.C. 1989 Nucleotide sequence of the maize R-S gene Nucl. Acids Res. 17 7092 7096

  • Quattrocchio, F., Verweij, W., Kroon, A., Spelt, C., Mol, J. & Koes, R. 2006 PH4 of petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic-helix–loop–helix transcription factors of the anthocyanin pathway Plant Cell 18 1274 1291

    • Search Google Scholar
    • Export Citation
  • Quattrocchio, F., Wing, J.F., Leppen, H.T.C., Mol, J.N.M. & Koes, R.E. 1993 Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes Plant Cell 5 1497 1512

    • Search Google Scholar
    • Export Citation
  • Quattrocchio, F., Wing, J., van der Woude, K., Souer, E., de Vetten, N., Mol, J. & Koes, R. 1999 Molecular analysis of the anthocyanin2 gene of petunia and its role in the evolution of flower color Plant Cell 11 1433 1444

    • Search Google Scholar
    • Export Citation
  • Quattrocchio, F., Wing, J.F., van der Woude, K., Mol, J.N.M. & Koes, R. 1998 Analysis of bHLH and MYB domain proteins: Species specific regulatory differences are caused by divergent evolution of target anthocyanin genes Plant J. 13 475 488

    • Search Google Scholar
    • Export Citation
  • Radicella, J.P., Turks, D. & Chandler, V.L. 1991 Cloning and nucleotide sequence of a cDNA encoding B-Peru, a regulatory protein of the anthocyanin pathway from maize Plant Mol. Biol. 17 127 130

    • Search Google Scholar
    • Export Citation
  • Sainz, M.B., Grotewold, E. & Chandler, V.L. 1997 Evidence for direct activation of an anthocyanin promoter by the maize C1 protein and comparison of DNA binding by related Myb domain proteins Plant Cell 9 611 625

    • Search Google Scholar
    • Export Citation
  • Sanford, J., Smith, F. & Russell, J. 1993 Optimizing the biolistic process for different biological applications Methods Enzymol. 217 483 509

  • Schocher, R.J., Shillito, R.D., Saul, M.W., Paszkowski, J. & Potrykus, I. 1986 Co-transformation of unlinked foreign genes into plants by direct gene transfer Biotechnology (N.Y.) 4 1093 1096

    • Search Google Scholar
    • Export Citation
  • Schwinn, K., Alm, V., Mackay, S., Davies, K. & Martin, C. 2001 Regulation of anthocyanin biosynthesis in Antirrhinum Acta Hort. 560 201 206

  • Spelt, C., Quattrocchio, F., Mol, J.N.M. & Koes, R. 2000 Anthocyanin1 of petunia encodes a basic helix–loop–helix protein that directly activates transcription of structural anthocyanin genes Plant Cell 12 1619 1632

    • Search Google Scholar
    • Export Citation
  • Tonelli, C., Consonni, G., Dolfini, S., Dellaporta, S.L., Viotti, A. & Gavazzi, G. 1991 Genetic and molecular analysis of Sn, a light-inducible, tissue specific regulatory gene in maize Mol. Gen. Genet. 225 401 410

    • Search Google Scholar
    • Export Citation
  • Winkel-Shirley, B. 2001 Flavonoid biosynthesis: A colorful model for genetics, biochemistry, cell biology, and biotechnology Plant Physiol. 126 485 493

    • Search Google Scholar
    • Export Citation
  • Yepes, L.M., Mittak, V., Pang, S.Z., Gonzalves, C., Slightom, J. & Gonsalves, D. 1995 Biolistic transformation of chrysanthemum with the nucleocapsid gene of tomato spotted wilt virus Plant Cell Rpt. 14 694 698

    • Search Google Scholar
    • Export Citation
  • Zhang, P., Chopra, S. & Peterson, T. 2000 A segmental gene duplication generated differentially expressed myb-homologous genes in maize Plant Cell 12 2311 2322

    • Search Google Scholar
    • Export Citation

Contributor Notes

This work was supported by a Cooperative Research and Development Agreement (58-3K95-5-1074) between Kerry's Bromeliad Nursery, McCorkle Nursery, and ARS.

Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

We thank Dr. Virginia Walbot (Stanford University) for providing us with the two regulatory genes MycLC (pAL69) and MybC1 (pAL70), and Dr. Bill Belknap (USDA-ARS-WRRC, Albany, CA) for the potato Ubi3 promoter.

Corresponding author. E-mail: robert.griesbach@ars.usda.gov.

  • View in gallery

    (A–C) Transactivation of anthocyanin synthesis in white Phalaenopsis amabilis petals after particle bombardment-mediated cotransformation of the S-MycLc and S-MybC1 constructs. (A) White P. amabilis flowers. (B) Anthocyanin accumulation viewed under white light. (C) Anthocyanin and enhanced green fluorescent protein accumulation viewed under near-ultraviolet light.

  • View in gallery

    Simultaneous detection of coexpression of enhanced green fluorescent protein (green, cytoplasm and nucleus) and anthocyanin (orange-red, vacuole) in the cells of white Phalaenopsis amabilis petals under near-ultraviolet light.

  • View in gallery

    (A–D) Different anthocyanin accumulation levels in white Phalaenopsis amabilis petals from transient expression of the two regulatory genes under the control of different promoters. (A) S-MycLc + S-MybC1. (B) U-MycLc + S-MybC1. (C) S-MycLc + U-MybC1. (D) U-MycLc + U-MybC1.

  • View in gallery

    (A–C) Activation of anthocyanin production in the unpigmented areas of Phalaenopsis stuartiana petals after introduction of S-MycLc and S-MybC1 constructs. (A) Phalaenopsis stuartiana flower. Induced anthocyanin expression (arrows) was viewed under white light (B) and near-ultraviolet light (C). A cluster of wild-type anthocyanin-expressing red cells were seen at the bottom of images B and C.

  • Borevitz, J.O., Xia, Y., Blount, J., Dixon, R.A. & Lamb, C. 2000 Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis Plant Cell 12 2383 2394

    • Search Google Scholar
    • Export Citation
  • Bovy, A., de Vos, R., Kemper, M., Schijlen, E., Almenar Pertejo, M., Muir, S., Collins, G., Robinson, S., Verhoeyen, M., Hughes, S., Santos-Buelga, C. & van Tunen, A. 2002 High-flavonol tomatoes resulting from the heterologous expression of the maize transcription factor genes LC and C1 Plant Cell 14 2509 2526

    • Search Google Scholar
    • Export Citation
  • Bowen, B. 1992 Anthocyanin genes as visual markers in transformed maize tissues 163 175 Gallagher S. GUS protocols: Using the GUS gene as reporter of gene expression Academic Press London

    • Search Google Scholar
    • Export Citation
  • Bradley, J.M., Davies, K.M., Deroles, S.C., Bloor, S.J. & Lewis, D.H. 1998 The maize Lc regulatory gene up regulates the flavonoid biosynthetic pathway of petunia Plant J. 13 381 392

    • Search Google Scholar
    • Export Citation
  • Brody, T.B. 1996 The interactive fly: A cyberspace guide to Drosophila development and metazoan evolution 27 Apr. 2007 <http://www.sdbonline.org/fly/aimain/1aahome.htm>.

    • Search Google Scholar
    • Export Citation
  • Bruce, W., Folkerts, O., Garnaat, C., Crasta, O., Roth, B. & Bowen, B. 2000 Expression profiling of the maize flavonoid pathway genes controlled by estradiol-inducible transcription factors CRC and P Plant Cell 12 65 80

    • Search Google Scholar
    • Export Citation
  • Chandler, V.L., Radicella, J.P., Robbins, T.P., Chen, J. & Turks, D. 1989 Two regulatory genes of the maize anthocyanin pathway are homologous: Isolation of B-utilizing R genomic sequences Plant Cell 1 1175 1183

    • Search Google Scholar
    • Export Citation
  • Cone, K.C., Burr, F.A. & Burr, B. 1986 Molecular analysis of the maize anthocyanin regulatory locus C1 Proc. Natl. Acad. Sci. USA 83 9631 9635

  • Davies, K. 2000 Plant colour and fragrance 127 163 Verpoortre R. & Alfermann A. Metabolic engineering of plant secondary metabolism Kluwer Academic Publishers Dordrecht, The Netherlands

    • Search Google Scholar
    • Export Citation
  • Dellaporta, S.L., Greenblatt, I., Kermicle, J., Hicks, J. & Wessler, S. 1988 Molecular cloning of the R-nj gene by transposon tagging with Ac 263 282 Gustafson J. & Appels R. Chromosome structure and function: Impact of new concepts Plenum Press New York

    • Search Google Scholar
    • Export Citation
  • deMajnik, J., Tanner, G., Joseph, R., Larkin, P., Weinman, J., Djordjevic, M. & Rolfe, B. 1998 Transient expression of maize anthocyanin regulatory genes influences anthocyanin production in white clover and peas Austral. J. Plant Phys. 25 335 343

    • Search Google Scholar
    • Export Citation
  • Elomaa, P., Mehto, M., Kotilainen, M., Helariutta, Y., Nevalainen, L. & Teeri, T.H. 1998 A bHLH transcription factor mediates organ, region and flower type specific signals on dihydroflavonol-4-reductase (dfr) gene expression in the inflorescence of Gerbera hybrida (Asteraceae) Plant J. 16 93 99

    • Search Google Scholar
    • Export Citation
  • Elomaa, P., Uimari, A., Mehto, M., Albert, V.A., Laitinen, R.A.E. & Teeri, T.H. 2003 Activation of anthocyanin biosynthesis in Gerbera hybrida (Asteraceae) suggests conserved protein–protein and protein–promoter interactions between the anciently diverged monocots and eudicots Plant Physiol. 133 1831 1842

    • Search Google Scholar
    • Export Citation
  • Garbarino, J. & Belknap, W. 1994 Isolation of a ubiquitin-ribosomal protein gene (ubi3) from potato and expression of its promoter in transgenic plants Plant Mol. Biol. 24 119 127

    • Search Google Scholar
    • Export Citation
  • Gill, G. & Ptashne, M. 1988 Negative effect of the transcriptional activator GAL4 Nature 334 721 724

  • Goldsbrough, A.P., Tong, Y. & Yoder, J.I. 1996 Lc as a non-destructive visual reporter and transposition excision marker gone for tomato Plant J. 9 927 933

    • Search Google Scholar
    • Export Citation
  • Gong, Z.Z., Yamagishi, E., Yamazaki, M. & Saito, K. 1999 A constitutively expressed Myc-like gene involved in anthocyanin biosynthesis from Perilla frutescens: Molecular characterization, heterologous expression in transgenic plants, and transactivation in yeast cells Plant Mol. Biol. 41 33 44

    • Search Google Scholar
    • Export Citation
  • Goodman, C.D., Casati, P. & Walbot, V. 2004 A multidrug resistance-associated protein involved in anthocyanin transport in Zea mays Plant Cell 16 1812 1826

    • Search Google Scholar
    • Export Citation
  • Goodrich, J., Carpenter, R. & Coen, E. 1992 A common gene regulates pigmentation pattern in diverse plant species Cell 68 995 964

  • Griesbach, R. 1990 Flavonoid copigments and anthocyanin of Phalaenopsis schilleriana Lindleyana 5 231 234

  • Griesbach, R. 2005 Biochemistry and genetics of flower color Plant Breed. Rev. 25 89 114

  • Griesbach, R. & Klein, T. 1993 In situ genetic complementation of a flower color mutant in Doritis pulcherrima (Orchidaceae) Lindleyana 8 223 226

  • Grotewold, E., Sainz, M.B., Tagliani, L., Hernandez, J.M., Bowen, B. & Chandler, V.L. 2000 Identification of the residues in the Myb domain of maize C1 that specify the interaction with the bHLH cofactor R Proc. Natl. Acad. Sci. USA 97 13579 13584

    • Search Google Scholar
    • Export Citation
  • Hanson, M.A., Gaut, B.S., Stec, A.O., Fuerstenberg, S.I., Goodman, M.M., Coe, E.H. & Doebley, J.F. 1996 Evolution of anthocyanin biosynthesis in maize kernels: The role of regulatory and enzymatic loci Genetics 143 1395 1407

    • Search Google Scholar
    • Export Citation
  • Hernandez, J.M., Heine, G.F., Irani, N.G., Feller, A., Kim, M.-G., Matulnik, T., Chandler, V.L. & Grotewold, E. 2004 Different mechanisms participate in the R-dependent activity of the R2R3 MYB transcription factor C1 J. Biol. Chem. 279 48205 48213

    • Search Google Scholar
    • Export Citation
  • Irani, N., Hernandez, J.M. & Grotewold, E. 2003 Regulation of anthocyanin pigmentation Recent Adv. Phytochem. 38 59 78

  • Koes, R., Verweij, W. & Quattrocchio, F. 2005 Flavonoids: A colorful model for the regulation and evolution of biochemical pathways Trends Plant Sci. 10 236 242

    • Search Google Scholar
    • Export Citation
  • Lee, M.H., Min, M.K., Lee, Y.J., Jin, J.B., Shin, D.H., Kim, D.H., Lee, K.-H. & Hwang, I. 2002 ADP-ribosylation factor 1 of Arabidopsis plays a critical role in intracellular trafficking and maintenance of endoplasmic reticulum morphology in Arabidopsis Plant Physiol. 129 1507 1520

    • Search Google Scholar
    • Export Citation
  • Lesnick, M.L. & Chandler, V.L. 1998 Activation of the maize anthocyanin gene a2 is mediated by an element conserved in many anthocyanin promoters Plant Physiol. 117 437 445

    • Search Google Scholar
    • Export Citation
  • Lloyd, A.M., Walbot, V. & Davis, R.W. 1992 Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and C1 Science 258 1773 1775

    • Search Google Scholar
    • Export Citation
  • Ludwig, S.R., Bowen, B., Beach, L. & Wessler, S.R. 1990 A regulatory gene as a novel visible marker for maize transformation Science 247 449 450

  • Ludwig, S.R., Habera, L.F., Dellaporta, S.L. & Wessler, S.R. 1989 Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region Proc. Natl. Acad. Sci. USA 86 7092 7096

    • Search Google Scholar
    • Export Citation
  • Mathews, H., Clendennen, S.K., Caldwell, C.G., Liu, X.L., Connors, K., Matheis, N., Schuster, D.K., Menasco, D.J., Wagoner, W., Lightner, J. & Wagner, D.R. 2003 Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport Plant Cell 15 1689 1703

    • Search Google Scholar
    • Export Citation
  • Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M. & Lepiniec, L. 2000 The TT8 gene encodes a basic helix–loop–helix domain protein required for expression of DFR and BAN genes in arabidopsis siliques Plant Cell 12 1863 1878

    • Search Google Scholar
    • Export Citation
  • Ni, M., Cui, D., Einstein, J., Narasimhulu, S., Vergara, C.E. & Gelvin, S.B. 1995 Strength and tissue specificity of chimeric promoters derived from the octopine and mannopine synthase genes Plant J. 7 661 676

    • Search Google Scholar
    • Export Citation
  • Paz-Ares, J., Ghosal, U., Wienand, U., Peterson, P. & Saedler, H. 1987 The regulatory c1 locus of Zea mays encodes a protein with homology to myb prto-oncogene products and with structural similarities to transcriptional activators EMBO J. 6 3553 3558

    • Search Google Scholar
    • Export Citation
  • Paz-Ares, J., Wienand, U., Peterson, P. & Saedler, H. 1986 Molecular cloning of the c locus of Zea mays: A locus regulating the anthocyanin pathway EMBO J. 5 829 833

    • Search Google Scholar
    • Export Citation
  • Perrot, G. & Cone, K.C. 1989 Nucleotide sequence of the maize R-S gene Nucl. Acids Res. 17 7092 7096

  • Quattrocchio, F., Verweij, W., Kroon, A., Spelt, C., Mol, J. & Koes, R. 2006 PH4 of petunia is an R2R3 MYB protein that activates vacuolar acidification through interactions with basic-helix–loop–helix transcription factors of the anthocyanin pathway Plant Cell 18 1274 1291

    • Search Google Scholar
    • Export Citation
  • Quattrocchio, F., Wing, J.F., Leppen, H.T.C., Mol, J.N.M. & Koes, R.E. 1993 Regulatory genes controlling anthocyanin pigmentation are functionally conserved among plant species and have distinct sets of target genes Plant Cell 5 1497 1512

    • Search Google Scholar
    • Export Citation
  • Quattrocchio, F., Wing, J., van der Woude, K., Souer, E., de Vetten, N., Mol, J. & Koes, R. 1999 Molecular analysis of the anthocyanin2 gene of petunia and its role in the evolution of flower color Plant Cell 11 1433 1444

    • Search Google Scholar
    • Export Citation
  • Quattrocchio, F., Wing, J.F., van der Woude, K., Mol, J.N.M. & Koes, R. 1998 Analysis of bHLH and MYB domain proteins: Species specific regulatory differences are caused by divergent evolution of target anthocyanin genes Plant J. 13 475 488

    • Search Google Scholar
    • Export Citation
  • Radicella, J.P., Turks, D. & Chandler, V.L. 1991 Cloning and nucleotide sequence of a cDNA encoding B-Peru, a regulatory protein of the anthocyanin pathway from maize Plant Mol. Biol. 17 127 130

    • Search Google Scholar
    • Export Citation
  • Sainz, M.B., Grotewold, E. & Chandler, V.L. 1997 Evidence for direct activation of an anthocyanin promoter by the maize C1 protein and comparison of DNA binding by related Myb domain proteins Plant Cell 9 611 625

    • Search Google Scholar
    • Export Citation
  • Sanford, J., Smith, F. & Russell, J. 1993 Optimizing the biolistic process for different biological applications Methods Enzymol. 217 483 509

  • Schocher, R.J., Shillito, R.D., Saul, M.W., Paszkowski, J. & Potrykus, I. 1986 Co-transformation of unlinked foreign genes into plants by direct gene transfer Biotechnology (N.Y.) 4 1093 1096

    • Search Google Scholar
    • Export Citation
  • Schwinn, K., Alm, V., Mackay, S., Davies, K. & Martin, C. 2001 Regulation of anthocyanin biosynthesis in Antirrhinum Acta Hort. 560 201 206

  • Spelt, C., Quattrocchio, F., Mol, J.N.M. & Koes, R. 2000 Anthocyanin1 of petunia encodes a basic helix–loop–helix protein that directly activates transcription of structural anthocyanin genes Plant Cell 12 1619 1632

    • Search Google Scholar
    • Export Citation
  • Tonelli, C., Consonni, G., Dolfini, S., Dellaporta, S.L., Viotti, A. & Gavazzi, G. 1991 Genetic and molecular analysis of Sn, a light-inducible, tissue specific regulatory gene in maize Mol. Gen. Genet. 225 401 410

    • Search Google Scholar
    • Export Citation
  • Winkel-Shirley, B. 2001 Flavonoid biosynthesis: A colorful model for genetics, biochemistry, cell biology, and biotechnology Plant Physiol. 126 485 493

    • Search Google Scholar
    • Export Citation
  • Yepes, L.M., Mittak, V., Pang, S.Z., Gonzalves, C., Slightom, J. & Gonsalves, D. 1995 Biolistic transformation of chrysanthemum with the nucleocapsid gene of tomato spotted wilt virus Plant Cell Rpt. 14 694 698

    • Search Google Scholar
    • Export Citation
  • Zhang, P., Chopra, S. & Peterson, T. 2000 A segmental gene duplication generated differentially expressed myb-homologous genes in maize Plant Cell 12 2311 2322

    • Search Google Scholar
    • Export Citation
All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 304 75 3
PDF Downloads 110 32 5