Late Blight Resistance of RB Transgenic Potato Lines

in Journal of the American Society for Horticultural Science
View More View Less
  • 1 Department of Crop and Soil Sciences, Michigan State University, East Lansing, MI 48824-1325

Late blight of potato (Solanum tuberosum L.), incited by Phytophthora infestans (Mont.) de Bary, is a devastating disease affecting tuber yield and storage. Recent work has isolated a resistance gene, RB, from the wild species Solanum bulbocastanum Dun. Earlier work in Toluca, Mexico, observed significant levels of field resistance under intense disease pressure in a somatic hybrid containing RB. In this study, five transgenic RB lines were recovered from the late blight susceptible line MSE149-5Y, from the Michigan State University (MSU) potato breeding program. Transgenic lines were molecularly characterized for the RB transgene, RB transcript, and insertion number of the kanamycin resistance gene NPTII. Transgenic lines and the parent line were evaluated for resistance in field and laboratory tests. Molecular characterization alone did not predict which lines were resistant. Three of the RB transformed MSE149-5Y lines showed increased resistance under field conditions at MSU and increased resistance in detached leaf evaluations using multiple isolates individually (US-1, US-1.7, US-8, US-10, and US-14). Transfer of RB into late blight susceptible and resistant lines could provide increased protection to potato late blight. The use of the RB gene for transformation in this way creates a partially cisgenic event in potato because the gene's native promoter and terminator are used. This type of transformation provides a chance to generate greater public acceptance of engineered approaches to trait introgression in food crops.

Abstract

Late blight of potato (Solanum tuberosum L.), incited by Phytophthora infestans (Mont.) de Bary, is a devastating disease affecting tuber yield and storage. Recent work has isolated a resistance gene, RB, from the wild species Solanum bulbocastanum Dun. Earlier work in Toluca, Mexico, observed significant levels of field resistance under intense disease pressure in a somatic hybrid containing RB. In this study, five transgenic RB lines were recovered from the late blight susceptible line MSE149-5Y, from the Michigan State University (MSU) potato breeding program. Transgenic lines were molecularly characterized for the RB transgene, RB transcript, and insertion number of the kanamycin resistance gene NPTII. Transgenic lines and the parent line were evaluated for resistance in field and laboratory tests. Molecular characterization alone did not predict which lines were resistant. Three of the RB transformed MSE149-5Y lines showed increased resistance under field conditions at MSU and increased resistance in detached leaf evaluations using multiple isolates individually (US-1, US-1.7, US-8, US-10, and US-14). Transfer of RB into late blight susceptible and resistant lines could provide increased protection to potato late blight. The use of the RB gene for transformation in this way creates a partially cisgenic event in potato because the gene's native promoter and terminator are used. This type of transformation provides a chance to generate greater public acceptance of engineered approaches to trait introgression in food crops.

Late blight of potato incited by Phytophthora infestans is responsible for significant annual losses in North America (Guenthner et al., 1999) and worldwide (Hijmans, 2003). The effect of climate change on potato production (Hijmans, 2003) and potato late blight (Baker et al., 2005) may result in reduced yield and increased risk of development of epidemics of potato late blight. Frequent fungicide spray intervals and rates currently used by growers to control late blight are expensive. Host resistance is an alternative control measure that is more economically and environmentally sustainable.

In the early 1900s, potato breeders successfully introgressed resistance from the Mexican wild species Solanum demissum Lindl. into cultivated potato (Muller and Black, 1952). However, major gene resistance from S. demissum was quickly overcome by P. infestans (Wastie, 1991). A total of 11 major dominant resistance genes (R genes) were identified from S. demissum (Malcolmson, 1969; Malcolmson and Black, 1966; Muller and Black, 1952). Most S. demissum R genes have been located to potato chromosomes and R1 and R3a have already been sequenced (Ballvora et al., 2002; Bradshaw et al., 2006; Huang et al., 2005). Although these genes have been defeated by P. infestans, there is some evidence that they may be useful when combined with other sources of resistance (Stewart et al., 2003).

As races of P. infestans overcame resistance from S. demissum researchers have turned to other Solanum L. species for resistance genes. A multitude of genes have been mapped, and several have been cloned and sequenced. The resistance gene RPi-ber, from Solanum berthaultii Hawkes, was mapped to chromosome X (Ewing et al., 2000; Rauscher et al., 2006). Rpi-moc1, identified in Solanum mochiquense Ochoa, mapped to chromosome IX (Smilde et al., 2005). Rpi-phu1 was identified from Solanum phureja Juz. et Buk. and mapped to chromosome IX (Śliwka et al., 2006). Rpi1 from Solanum pinnatisectum Dun. was mapped to chromosome VII (Kuhl et al., 2001). A major QTL from Solanum microdontum Bitt. (Bisognin et al., 2005) was recently mapped to chromosome IV (D.S. Douches, unpublished data). Solanum bulbocastanum has yielded several resistance genes. Two alleles from a single locus on chromosome VIII were identified and cloned, RB (Song et al., 2003) and Rpi-blb1 (van der Vossen et al., 2003). Rpi-blb2 was localized to chromosome VI and subsequently cloned (van der Vossen et al., 2005). Another gene, Rpi-blb3, has been mapped to chromosome IV (Park et al., 2005).

The increasing pool of genes conveying resistance to late blight of potato raises the question of how to incorporate such resistance into cultivated lines. The cultivated potato, S. tuberosum, is tetraploid (4x) with an endosperm balance number (EBN) of 4, resulting in crossing barriers with wild Solanum species that differ in ploidy or EBN (Hanneman, 1999). Although classical methodologies have been used to overcome such barriers (Hermsen and Ramanna, 1973), the desire to incorporate more than one source of resistance presents increased challenges for the potato breeder. Plant transformation offers an efficient method to transfer genes from divergent organisms directly into the plant genome (Sharma et al., 2005). Transformation also allows both the quantity, through gene pyramiding, and timing of resistance genes to be controlled on a relatively short time scale.

Resistance genes are potentially useful control measures for potato late blight. Both RB and Rpi-blb1 have broad-spectrum resistance and conferred resistance to a range of isolates of P. infestans carrying multiple virulence factors (Song et al., 2003; van der Vossen et al., 2003). RB has also been shown to maintain resistance in Toluca, Mexico under intense disease pressure (Helgeson et al., 1998). However, successful insertion of a transgene into the genome does not guarantee a positive phenotype. van der Vossen et al. (2003) reported that 15 of 18 Rpi-blb1 transformed potato lines were resistant and seven of nine tomato (Solanum lycopersicum L.) transformants showed resistance. Song et al. (2003) reported that of 14 RB transformed lines, 5 were highly resistant and 9 were moderately resistant, having <10% and 11% to 25% infection, respectively, in comparison with non-transformed lines. Successful transformation requires confirmation that the gene or genes are not only intact and transcribed/translated but that the desired phenotype is also recovered.

The objectives of this study were to evaluate the recovery of effectively transformed progeny plants of the potato advanced breeding line MSE149-5Y and to determine the resistance of these transformed lines to different genotypes of P. infestans in detached leaf tests and the field.

Materials and Methods

Generation of transgenic lines.

Michigan State University breeding line MSE149-5Y was used for all transformations reported here. MSE149-5Y is not known to have any major late blight R gene. Plasmid 2.4.48pCRXLTOPO (J. Jiang, personal communication) was digested with BamHI, and the 8.59-kb fragment containing RB was isolated, including 2.5 kb upstream of the start ATG and 2.48 kb downstream of the stop codon. This fragment was ligated to pBINPLUSARS (U.S. Department of Agriculture, Albany, CA) (Garbarino and Belknap, 1994), which had been digested with BamHI, and the new construct called pSPUD69 (Fig. 1). Agrobacterium tumefaciens (Smith & Towns.) Conn.-mediated transformations using a kanamycin marker were conducted according to Douches et al. (1998). The explants were prepared for transformation by cutting internodes of the stem from tissue culture plantlets. When callus nodules produced shoots 5–7 mm in length, the shoots were excised and placed in rooting medium (modified MS medium with the addition of kanamycin at 50 mg L−1 to identify successful transformants) in 25 × 150-mm culture tubes. A single shoot was removed from each callus to ensure selection from independent transformation events. Rooted transformants expressing resistance to kanamycin were maintained by micropropagation. Rooted putative transgenic plants in the MSE149-5Y background were denoted as E69 followed by the shoot number.

Fig. 1.
Fig. 1.

T-DNA region of pSPUD69. RGA2-PCR indicates the 8.59-kb BamHI fragment containing the RB gene ligated into the pBINPLUSARS base plasmid. This construct includes the NPTII gene for kanamycin resistance controlled by the ubiquitin (Ubi3) promoter (Pro) and terminator (Term). Natural promoter (2503-bp upstream) and termination sequences (2477-bp downstream) were used for RB. The region in the T-DNA where the RB primers anneal is designated by “PCR Product.”

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 132, 6; 10.21273/JASHS.132.6.783

Molecular characterization.

DNA extractions were conducted using a 2× CTAB procedure (Doyle and Doyle, 1987). Detection of transgene insertions used 30 ng of total genomic DNA at a final concentration of 1.5 mg L−1. REDTaq DNA Polymerase (Sigma-Aldrich Co., St. Louis) was used following the manufacturer's directions. RB primers specific for the resistant allele (Colton et al., 2006) amplified a 213-bp fragment (forward, 5′ CACGAGTGCCCTTTTCTGAC 3′ and reverse, 5′ ACAATTGAATTTTTAGACTT 3″). NPTII primers amplified a 267-bp fragment (forward 5′ CGCAGGTTCTCCGGCCGCTTGGGTGG 3′ and reverse, 5′ AGCAGCCAGTCCCTTCCCGCTTCA 3′). RB and NPTII primers were annealed at 43 and 60 °C, respectively. A PerkinElmer 9600 thermal cycler (Wellesley, MA) was programmed for a hot start (95 °C, 5 min) and 35 cycles of 95 °C, 30 s denaturing, 43 °C or 60 °C, 30 s annealing, and 72 °C, and 30 s extension, with a final extension of 72 °C, 5 min. Fragments were separated on 1.0% agarose gel.

RNA extractions were conducted using the RNeasy Plant Mini Kit (QIAGEN, Valencia, CA). One microgram of RNA was treated with deoxyribonuclease I (Invitrogen Corp., Carlsbad, CA) and inactivated according to the manufacturer's guidelines. cDNA was generated from total RNA using M-MLV Reverse Transcriptase (Invitrogen Corp.) according to the manufacturer's guidelines. Polymerase chain reaction (PCR) was conducted with REDTaq DNA Polymerase (Sigma-Aldrich Co.) according to the manufacturer's guidelines. RB and NPTII primers were the same as above. Positive control was EF1α (forward, 5′ GGTGGTTTTGAAGCTGGTATCTCC 3′ and reverse, 5′ CCAGTAGGGCCAAAGGTCACA 3′), 50 °C annealing temperature. Fragments were separated on 1.0% agarose gel.

Southern hybridizations.

Twenty micrograms of endorestriction-digested (BamHI, EcoRI, and HindIII) DNA per sample was transferred to Amersham Hybond-N+ membrane (GE Healthcare, Piscataway, NJ) using a standard alkaline lysis procedure (Kennard et al., 1994). Isolated fragments of RB and NPTII were labeled with [α-32P]dCTP with the Random Primers DNA Labeling system (Invitrogen Corp.), and un-incorporated nucleotides were removed with Bio-Spin 30 Tris columns (Bio-Rad, Hercules, CA). Hybridizations were conducted as described in Kuhl et al. (2001). Hybridization with RB used a 1562-bp fragment, bp 1794 through bp 3356 from ATG, including the 213-bp region used to distinguish resistant and susceptible alleles. Highly stringent final wash conditions were used 0.1× SSC and 0.1% SDS for a total of 52 min at 60 °C. Hybridization with NPTII used a 700-bp fragment. The final wash condition included 2× SSC, 0.1% SDS for 30 min at 50 °C followed by 0.1× SSC, 0.1% SDS for 20 min at 60 °C.

Detached leaf tests.

Isolates of different genotypes of P. infestans used in detached leaf tests are described in Table 1. Isolates were transferred through healthy, detached leaflets of a susceptible cultivar (Red Craig's Royal, not known to contain any R-genes) within 1 year of the conducted tests. Sporangial/zoospore suspensions were derived from each isolate using three to five 13-d-old cultures grown on rye A agar (Caten and Jinks, 1968). Sporangia were released from the surface of the plate by immersion in sterile distilled water (SDW), followed by scraping with a sterile glass rod. Zoospore release was stimulated by incubation for 2 h at 4 °C, followed by warming at 18 °C for 30 min. Suspensions were subsequently examined using a binocular microscope to confirm the release of zoospores, calibrated by counting with a hemocytometer and adjusted to about 2.0 × 104 sporangia/mL using SDW (Kuhl et al., 2001).

Table 1.

Phytophthora infestans isolates independently used in potato detached leaf evaluations at 2.0 × 104 sporangia/mL sprayed on the abaxial leaf surface and incubated at 17 °C for 12 d.

Table 1.

Inoculations were conducted essentially according to Kuhl et al. (2001) on 12 Dec. 2004 and replicated 3 Jan. 2005. Five plants per line of greenhouse-grown plants were used. Five fully developed leaves were selected from the upper portion of each plant and one leaf randomly assigned per P. infestans isolate, so that five leaves total were used per isolate. Three layers of absorbent paper towels were placed in the bottom of 150-mm-diameter petri dishes with a layer of plastic mesh on top, and 38 mL of SDW was added to the towels in each plate. Detached leaves were placed abaxial side up on the plastic mesh and then sprayed using a hand-held sprayer, once with SDW and once with P. infestans inoculum (0.7-mL spray volume per plate per spray). Petri dishes were wrapped with parafilm and placed into dark incubators at 17 °C with 12-h light cycle. For all experiments incubator shelves and positions were randomized. Pi95-3 (US-1) and Pi99-2 (US-14) did not produce sufficient sporangia although ≈1.0 × 103 sporangia/mL were used at both inoculations for Pi95-3 and ≈2.0 × 104 and ≈1.4 × 103 sporangia/mL were used for Pi99-2 at inoculations 1 and 2, respectively. Leaves were scored at 6, 9, and 12 d after inoculation (DAI) using disease severity indices (DSI) based on percentage of leaf area affected: 0 = no symptoms, 1 = 0% to 5%, 3 = 6% to 25%, 5 = 26% to 50%, 7 = 51% to 75%, 9 = 76% to 100% (Kuhl et al., 2001). Scores were converted to mean percentage values by using the midpoint value in each interval (Haynes et al., 1998). Percentages were used to calculate area under the disease progress curve (AUDPC) according to Shaner and Finney (1977) and analysis of variance conducted using XLSTAT (version 2006.5; Addinsoft, New York, NY).

Field evaluations.

Inoculated fields trials were conducted in 2004 and 2005 at the Michigan Agricultural Experimental Station Muck Soils Research Farm, Laingsburg, MI. Plots were irrigated as necessary to maintain canopy and soil moisture conditions conducive for development of foliar late blight (Kirk et al., 2005) with turbine rotary garden sprinklers (Gilmour Group, Somerset, PA) at 1.05 L·ha−1 of water per hour and managed under standard potato agronomic practices.

In 2004, five tissue-culture-derived plants per plot were transplanted to the field and each line replicated twice. Inoculation in 2004 used a mixture of isolates later used in detached leaf test and listed in Table 1, except for SR83-84 (US-10). In 2005, 10 tissue-culture-derived plants per plot were transplanted to the field and replicated 3 times. The most promising resistance lines were retested in 2005, thereby dropping E69.03 and E69.04. All the isolates listed in Table 1 and isolates Pi96-2 (US-1.7), Pi95-7, Pi02-003, Pi02-006 (US-8), Pi96-1 (US-11), and Pi94-2, Pi98-1, and Pi00-001 (US-14) were used to inoculate the field plots in 2005. Sporangia were counted with a hemacytometer and the concentration was adjusted to ≈2.0 × 104 sporangia/mL using SDW. The sporangial solution was chilled to 4 °C for 8 h to promote release of zoosporangia from the sporangia. All plots were inoculated simultaneously in both years using an overhead sprinkler irrigation system. The zoospore suspension of mixed isolates of P. infestans was injected into the irrigation water feed pipeline under 0.5 kg·cm−2 of CO2 pressure and applied at a rate of ≈150 mL·m−2 of inoculum solution of trial area to give an inoculation rate of about 2.4 × 106 zoosporangia/m2 (2.4 × 1010 zoospores·ha−1). This amount and rate of inoculum applied were estimated from prior calibration of the irrigation system and were intended to expose all potato foliage to inoculum of P. infestans.

As soon as late blight symptoms were detected (about 7 DAI), each plant within each plot was visually rated at 3- to 5-d intervals for percent leaf and stem (foliar) area with late blight lesions. The mean percent blighted foliar area per treatment was calculated. Evaluations continued until plots of susceptible cultivars reached 100% foliar area diseased. DAI to the time until 100% foliar area in susceptible cultivars diseased was reached was used as a key reference point for calculation of relative area under the disease progress curve [RAUDPC (Kirk et al., 2001)]. Analysis of variance was calculated using JMP (version 5.0.1; SAS Institute Inc., Cary, NC).

Results

Molecular evaluations.

PCR tests on total genomic DNA revealed five transformants of MSE149-5Y transformed for both RB and NPTII (Fig. 2). In addition to the two lines in Fig. 2, E69.02 and E69.10, >150 other lines tested positive for NPTII but failed to amplify the fragment from RB (data not shown). As a consequence, screening of newly transformed lines required testing for both NPTII and RB.

Fig. 2.
Fig. 2.

PCR amplification of RB and NPTII fragments from total potato DNA. The expected RB fragment is 213 bp. Lanes E69.01, E69.02, E69.03, E69.04, E69.05, E69.06, and E69.10 are putative transformants; lane MSE149-5Y, untransformed control; lane M, 100-bp DNA ladder.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 132, 6; 10.21273/JASHS.132.6.783

In an effort to determine copy number of the transformed plants, a Southern blot was hybridized with the RB fragment. The RB fragment used includes sequence before the leucine-rich repeat (LRR) region and 1113 bp of LRR, including the 213-bp region used to distinguish RB from other alleles. In anticipation that the labeled fragment would hybridize to numerous genes in S. tuberosum, a highly stringent final wash was used. Despite this effort, the RB fragment hybridized to many regions within the potato genome (data not shown). No bands could be identified as specific to the RB transgene. Due to the nature of the construct used (Fig. 1), NPTII could be used to approximate RB copy number.

A 700-bp fragment from NPTII was hybridized to the five RB transformed lines (Fig. 3). Four of the lines showed a single labeled fragment—E69.01, E69.03, E69.04, and E69.06—suggesting the transgene inserted into a single site in the genome. Lane 4, E69.05, contains two NPTII labeled fragments, suggesting two separate insertion events.

Fig. 3.
Fig. 3.

Southern hybridization of BamHI-digested total potato DNA with NPTII 700-bp fragment, 5-d exposure. Lanes E69.01, E69.03, E69.04, E69.05, and E69.06 are putative transformants; lane MSE149-5Y, untransformed control.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 132, 6; 10.21273/JASHS.132.6.783

Reverse-transcribed PCR (RT-PCR) was used to evaluate for transcription of the RB and NPTII transgenes. Lines E69.01–E69.06 detected NPTII transcript, while RB transcript was detected in lines E69.03, E69.04, E69.05, and E69.06 (Fig. 4). Notably, RB transcript was not detected in line E69.01, even though the RB fragment amplified from total genomic DNA (Fig. 2). The absence of RB transcript is expected for E69.02 and E69.11, both of which lack the amplified RB fragment.

Fig. 4.
Fig. 4.

Reverse-transcribed PCR of RB, NPTII, and EF1α. Expected fragments of RB, NPTII, and EF1α are 213, 267, and 400 bp, respectively. Lanes E69.01, E69.02, E69.03, E69.04, E69.05, E69.06, and E69.11 are putative potato transformants; lane MSE149-5Y, untransformed potato control; lane M, 1-kb DNA ladder.

Citation: Journal of the American Society for Horticultural Science J. Amer. Soc. Hort. Sci. 132, 6; 10.21273/JASHS.132.6.783

Detached leaf tests.

Detached leaflet tests indicated that there were no significant differences in AUDPC among lines of MSE149-5Y transformed with the RB gene inoculated with P. infestans isolates Pi95-3 (US-1), Pi95-2 (US-1.7), Pi02-007 (US-8), or Pi99-2 (US-14) (Table 2). With isolate SR83-84 (US-10), lines E69.03, E69.05, and E69.06 had significantly lower AUDPC values (31–35) than lines with AUDPC values from 154 to 190 (Table 2).

Table 2.

Effect of transformation of potato line MSE149-5Y with RB on susceptibility to Phytophthora infestans in detached leaf tests scored at 6, 9, and 12 DAI.

Table 2.

Field data.

Foliar potato late blight developed steadily after inoculation in 2004, and the RAUDPC value in the untransformed line MSE149-5Y was 47.7 (41 DAI; Table 3). RAUDPC values of lines E69.03, E69.05, and E69.06 in 2004 ranged from 0.7 to 6.3 and were significantly lower (P = 0.05) values than the untransformed MSE149-5Y. Line E69.04 had a significantly greater RAUDPC value (27.8) than the three most resistant lines but significantly lower than the untransformed line (Table 3). In 2004, line E69.01 had a significantly greater RAUDPC value (38.8) than E69.04 (27.8) but significantly less than MSE149-5Y (47.7). In 2005, the epidemic progressed more slowly, and by 45 DAI the RAUDPC value in the untransformed line MSE149-5Y was 19.8 (Table 3). The RAUDPC value for E69.01 (19.5) was not significantly different from the value for MSE149-5Y (19.8). Lines E69.05 and E69.06 in 2004 had RAUDPC values from 1.8 to 4.5 and were significantly lower (P = 0.05) values than the untransformed MSE149-5Y.

Table 3.

Effect of transformation of potato line MSE149-5Y with the RB gene on susceptibility to Phytophthora infestans in field plots at the Michigan Agricultural Experimental Station Muck Soils Research Farm at Laingsburg in 2004 and 2005.

Table 3.

Discussion

Both field and detached leaf tests detected increased levels of late blight resistance in three transformed lines, E69.03, E69.05, and E69.06. In the case of E69.01 molecular data, presence of RB fragment (Fig. 2) but absence of RB transcript (Fig. 4) accurately predicted a susceptible phenotype in both laboratory and field evaluations. However, E69.04, a susceptible phenotype that contains the RB DNA fragment and transcript, would not have been detected without laboratory or field phenotypic testing. Phenotype screening is needed to accurately determine which transformed lines are worth carrying forward.

Detached leaf tests accurately predicted field resistance in lines E69.03, E69.05, and E69.06. This interpretation was only good for the US-10 isolate, SR83-84. Isolates Pi95-3 and Pi99-2 both produced suboptimum sporangia concentrations resulting in highly variable phenotypes. P. infestans US-8 isolate Pi02-007 was particularly aggressive and successfully infected all lines evaluated in detached leaf tests. This same isolate was also applied in field inoculations, but resistance was clearly observed in lines E69.03, E69.05, and E69.06. The most likely explanation is that conditions of the detached leaf test were too stringent for this isolate and that leaves were overcome by density of inoculum. Stewart (1990) found that the best inoculum concentration to distinguish resistant and susceptible phenotypes is likely to depend on the isolate. Adjustment of the inoculum concentration may help resolve susceptible and resistant phenotypes. Both RB and Rpi-blb1 are reported to contribute broad-spectrum resistance to all P. infestans races (Song et al., 2003; van der Vossen et al., 2003). However, Pi02-007 has been observed to be a highly aggressive isolate (Young et al., 2004), suggesting that lower concentration of inoculum may be required to detect resistant phenotypes. In this report, Pi02-007 was significantly different from the other isolates (P ≤ 0.01) with the highest mean AUDPC, 412 ± 120. Use of multiple isolates reported here allowed accurate detection of transgenic resistance in laboratory tests and corroborated field results.

Transformation efficiency was very low in this study. The low efficiency is unexpected with MSE149-5Y, which has proven to be particularly receptive (75% regeneration rate) to transformation (D.S. Douches, unpublished data). The use of the pSPUD69 construct resulted in many NPTII positive/RB negative transgenic lines. A greater number of lines should be generated so that the true range of expression of this gene can be studied. It also would be valuable to express RB in other late blight resistant germplasm. However, the low recovery of RB positive lines has restricted transfer of RB to conventionally bred late blight resistant lines because the late blight resistant genotypes were not responsive to callus regeneration (D.S. Douches, unpublished data). Studies must be conducted to understand this phenomenon so that greater numbers of RB lines can be generated for evaluation.

Determination of RB copy number relied on hybridization with a NPTII fragment. A single band was observed for four of five RB-containing lines, suggesting a single insertion of RB. However, this does not exclude the possibility of a closely linked tandem insertion or the possibility of additional RB insertions with the loss of NPTII. This highlights a challenge for researchers using potato genes to transform potato. One alternative approach is to use real-time PCR to estimate copy number (Ingham et al., 2001) using gene- and/or allele-specific primers. An unsuccessful effort using RB-specific primers attempted to do just that (J.C. Kuhl, unpublished data). Failure may in part be due to the low annealing temperature of the RB primers (43 °C) and the challenge to identify alternative primers. RB, a coiled coil–nucleotide binding site–leucine-rich repeat class resistance gene (Martin et al., 2003), is expected to be homologous with other potato resistance genes, as demonstrated by hybridization with RB, making allele specific primers difficult to identify.

The 213-bp RB fragment was amplified from genomic DNA of line E69.01, but RB transcript was not detected. This could be explained by a partial deletion/rearrangement of the RB transgene, leaving intact the 213-bp DNA region, but inactivating or truncating transcription. Another possibility is post-transcriptional silencing, as observed in other transgenic lines (Felcher et al., 2003).

As transformation technologies become more efficient greater numbers of putatively transformed lines will be generated. Molecular characterization does not guarantee a resistant phenotype. Field evaluations require propagation of the desired lines and large-scale preparation and deployment of P. infestans inoculum, in addition to regular field observations throughout disease development. Therefore, it may not be desirable to take all putative transformed lines to the field. As evidenced by correlation of detached leaf assays and field results, screening of transformants in the laboratory before field evaluations will contribute to more efficient use of field space.

RB may be useful creating late blight resistant phenotypes in either susceptible or resistant cultivars of potato. Cultivar × fungicide studies, as previously conducted by Kirk et al. (2005), should be conducted to determine the best way to integrate protectant fungicides and host plant resistance to achieve late blight control for commercial conditions. These lines generated can be used for further breeding to introgress RB into additional germplasm.

The use of the RB gene from S. bulbocastanum for transformation creates a partially cisgenic event in potato because the gene's native promoter and terminator is also used. This type of transformation creates an opportunity to generate greater public acceptance of engineered approaches to trait introgression in our food crops. Currently, the NPTII gene is also in the vector construct T-DNA region. Transformation methods exist to create marker-free transgenics in potato (Rommens et al., 2004). Further transformations in our program have created RB-transgenic lines in which RB is inserted independently from NPTII. Through crossing we may be able to identify RB-positive/NPTII-negative transgenic lines for further breeding.

Literature Cited

  • Ballvora, A., Ercolano, M.R., Weiß, J., Meksem, K., Bormann, C.A., Oberhagemann, P., Salamini, F. & Gebhardt, C. 2002 The R1 gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes Plant J. 30 361 371

    • Search Google Scholar
    • Export Citation
  • Baker, K.M., Kirk, W.W., Stein, J.M. & Andresen, J.A. 2005 Climatic trends and potato late blight risk in the Upper Great Lakes region HortTechnology 15 510 518

    • Search Google Scholar
    • Export Citation
  • Bisognin, D.A., Douches, D.S., Buszka, L., Bryan, G. & Wang, D. 2005 Mapping late blight resistance in Solanum microdontum Bitter Crop Sci. 45 340 345

  • Bradshaw, J.E., Bryan, G.J., Lees, A.K., McLean, K. & Solomon-Blackburn, R.M. 2006 Mapping the R10 and R11 genes for resistance to late blight (Phytophthora infestans) present in the potato (Solanum tuberosum) R-gene differentials of Black Theor. Appl. Genet. 112 744 751

    • Search Google Scholar
    • Export Citation
  • Caten, C.E. & Jinks, J.L. 1968 Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation Can. J. Bot. 46 329 348

  • Colton, L.M., Groza, H.I., Wielgus, S.M. & Jiang, J. 2006 Marker-assisted selection for the broad-spectrum potato late blight resistance conferred by gene RB derived from a wild potato species Crop Sci. 46 589 594

    • Search Google Scholar
    • Export Citation
  • Douches, D.S., Westedt, A.L., Zarka, K., Schroeter, B. & Grafius, E.J. 1998 Potato transformation to combine natural and engineered resistance for controlling tuber moth HortScience 33 1053 1056

    • Search Google Scholar
    • Export Citation
  • Doyle, J.J. & Doyle, J.L. 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue Phytochem. Bul. 19 11 15

  • Ewing, E.E., Šimko, I., Smart, C.D., Bonierbale, M.W., Mizubuti, E.S.G., May, G.D. & Fry, W.E. 2000 Genetic mapping from field tests of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii Mol. Breed. 6 26 36

    • Search Google Scholar
    • Export Citation
  • Felcher, K.J., Douches, D.S., Kirk, W.W., Hammerschmidt, R. & Li, W. 2003 Expression of a fungal glucose oxidase gene in three potato cultivars with different susceptibility to late blight (Phytophthora infestans Mont. de Bary) J. Amer. Soc. Hort. Sci. 128 238 245

    • Search Google Scholar
    • Export Citation
  • Garbarino, J.E. & Belknap, W.R. 1994 Isolation of a ubiquitin-ribosomal protein gene (ubi3) from potato and expression of its promoter in transgenic plants Plant Mol. Biol. 24 119 127

    • Search Google Scholar
    • Export Citation
  • Goodwin, S.B., Schneider, R.E. & Fry, W.E. 1995 Use of cellulose–acetate electrophoresis for rapid identification of allozyme genotypes of Phytophthora infestans Plant Dis. 79 1181 1185

    • Search Google Scholar
    • Export Citation
  • Guenthner, J.F., Wiese, M.V., Pavlista, A.D., Sieczka, J.B. & Wyman, J. 1999 Assessment of pesticide use in the US potato industry Amer. J. Potato Res. 76 25 29

    • Search Google Scholar
    • Export Citation
  • Hanneman, R.E. 1999 The reproductive biology of the potato and its implication for breeding Potato Res. 42S 283 312

  • Haynes, K.G., Lambert, D.H., Christ, B.J., Weingartner, D.P., Douches, D.S., Backlund, J.E., Secor, G., Fry, W. & Stevenson, W. 1998 Phenotypic stability of resistance to late blight in potato clones evaluated at eight sites in the United States Amer. J. Potato Res. 75 211 217

    • Search Google Scholar
    • Export Citation
  • Helgeson, J.P., Pohlman, J.D., Austin, S., Haberlach, G.T., Wielgus, S.M., Ronis, D., Zambolim, L., Tooley, P., McGrath, J.M., James, R.V. & Stevenson, W.R. 1998 Somatic hybrids between Solanum bulbocastanum and potato: a new source of resistance to late blight Theor. Appl. Genet. 96 738 742

    • Search Google Scholar
    • Export Citation
  • Hermsen, J.G.T. & Ramanna, M.S. 1973 Double-bridge hybrids of Solanum bulbocastanum and cultivars of Solanum tuberosum Euphytica 22 457 466

  • Hijmans, R.J. 2003 The effect of climate change on global potato production Amer. J. Potato Res. 80 271 280

  • Huang, S., van der Vossen, E.A.G., Kuang, H., Vleeshouwer, V.G.A.A., Zhang, N., Borm, T.J.A., van Eck, H.J., Baker, B., Jacobsen, E. & Visser, R.G.F. 2005 Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato Plant J. 42 251 261

    • Search Google Scholar
    • Export Citation
  • Ingham, D.J., Beer, S., Money, S. & Hansen, G. 2001 Quantitative real-time PCR assay for determining transgene copy number in transformed plants Biotechniques 31 132 141

    • Search Google Scholar
    • Export Citation
  • Kennard, W.K., Poetter, K., Dijkhuizen, A., Meglic, V., Staub, J.E. & Havey, M.J. 1994 Linkages among RFLP, RAPD, isozyme, disease resistance, and morphological markers in narrow and wide crosses of cucumber Theor. Appl. Genet. 89 42 48

    • Search Google Scholar
    • Export Citation
  • Kirk, W.W., Felcher, K.J., Douches, D.S., Coombs, J.M., Stein, J.M., Baker, K.M. & Hammerschmidt, R. 2001 Effect of host plant resistance and reduced rates and frequencies of fungicide application to control potato late blight Plant Dis. 85 1113 1118

    • Search Google Scholar
    • Export Citation
  • Kirk, W.W., Abu-El Samen, F.M., Muhinyuza, J.B., Hammerschmidt, R., Douches, D.S., Thill, C.A., Groza, H. & Thompson, A.L. 2005 Evaluation of potato late blight management utilizing host plant resistance and reduced rates and frequencies of fungicide applications Crop Prot. 24 961 970

    • Search Google Scholar
    • Export Citation
  • Kuhl, J.C., Hanneman, R.E. & Havey, M.J. 2001 Characterization and mapping of Rpi1, a late blight resistance locus from diploid (1EBN) Mexican Solanum pinnatisectum Mol. Genet. Genomics 265 977 985

    • Search Google Scholar
    • Export Citation
  • Malcolmson, J.F. 1969 Factors involved in resistance to blight (Phytophthora infestans (Mont.) de Bary) in potatoes and assessment of resistance using detached leaves Ann. Appl. Biol. 64 461 468

    • Search Google Scholar
    • Export Citation
  • Malcolmson, J.F. & Black, W. 1966 New R genes in Solanum demissum Lindl. and their complementary races of Phytophthora infestans (Mont.) de Bary Euphytica 15 199 203

    • Search Google Scholar
    • Export Citation
  • Martin, G.B., Bogdanove, A.J. & Sessa, G. 2003 Understanding the functions of plant disease resistance proteins Annu. Rev. Plant Biol. 54 23 61

  • Muller, K.O. & Black, W. 1952 Potato breeding for resistance to blight and virus diseases during the last hundred years Zt. Pflanzenzucht. 31 305 318

    • Search Google Scholar
    • Export Citation
  • Park, T.-H., Gros, J., Sikkema, A., Vleeshouwers, V.G.A.A., Muskens, M., Allefs, S., Jacobsen, E., Visser, R.G.F. & van der Vossen, E.A.G. 2005 The late blight resistance locus Rpi-blb3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on chromosome 4 of potato Mol. Plant Microbe Interact. 18 722 729

    • Search Google Scholar
    • Export Citation
  • Rauscher, G.M., Smart, C.D., Simko, I., Bonierbale, M., Mayton, H., Greenland, A. & Fry, W.E. 2006 Characterization and mapping of Rpi-ber, a novel potato late blight resistance gene from Solanum berthaultii Theor. Appl. Genet. 112 674 687

    • Search Google Scholar
    • Export Citation
  • Rommens, C.M., Humara, J.M., Ye, J.S., Yan, H., Richael, C., Zhang, L., Perry, R. & Swords, K. 2004 Crop improvement through modification of the plant's own genome Plant Physiol. 135 421 431

    • Search Google Scholar
    • Export Citation
  • Shaner, G. & Finney, R.E. 1977 The effect of nitrogen fertilization on the expression of slow-mildewing resistance in Knox wheat Phytopathology 67 1051 1056

    • Search Google Scholar
    • Export Citation
  • Sharma, K.K., Bhatnagar-Mathur, P. & Thorpe, T.A. 2005 Genetic transformation technology: status and problems In Vitro Cell. Dev. Biol. Plant 41 102 112

    • Search Google Scholar
    • Export Citation
  • Śliwka, J., Jakuczun, H., Lebecka, R., Marczewski, W., Gebhardt, C. & Zimnock-Guzowska, E. 2006 The novel, major locus Rpi-phu1 for late blight resistance maps to potato chromosome IX and is not correlated with long vegetation period Theor. Appl. Genet. 113 685 695

    • Search Google Scholar
    • Export Citation
  • Smilde, W.D., Brigneti, G., Jagger, L., Perkins, S. & Jones, J.D.G. 2005 Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1 Theor. Appl. Genet. 110 252 258

    • Search Google Scholar
    • Export Citation
  • Song, J., Bradeen, J.M., Naess, S.K., Raasch, J.A., Wielgus, S.M., Haberlach, G.T., Liu, J., Kuang, H., Austin-Phillips, S., Buell, C.R., Helgeson, J.P. & Jiang, J. 2003 Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight Proc. Natl. Acad. Sci. USA 100 9128 9133

    • Search Google Scholar
    • Export Citation
  • Stewart, H.E. 1990 Effect of plant age and inoculum concentration on expression of major gene resistance to Phytophthora infestans in detached potato leaflets Mycol. Res. 94 823 826

    • Search Google Scholar
    • Export Citation
  • Stewart, H.E., Bradshaw, J.E. & Pande, B. 2003 The effect of the presence of R-genes for resistance to late blight (Phytophthora infestans) of potato (Solanum tuberosum) on the underlying level of field resistance Plant Physiol. 52 193 198

    • Search Google Scholar
    • Export Citation
  • van der Vossen, E., Sikkema, A., Hekkert, B.L., Gros, J., Stevens, P., Muskens, M., Wouters, D., Pereira, A., Stiekema, W. & Allefs, S. 2003 An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato Plant J. 36 867 882

    • Search Google Scholar
    • Export Citation
  • van der Vossen, E.A.G., Gros, J., Sikkema, A., Muskens, M., Wouters, D., Wolters, P., Pereira, A. & Allefs, S. 2005 The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog conferring broad-spectrum late blight resistance in potato Plant J. 44 208 222

    • Search Google Scholar
    • Export Citation
  • Wastie, R.L. 1991 Breeding for resistance 193 224 Ingram D.S. & Williams P.H. Phytophthora infestans: the cause of late blight of potato. Advances in Plant Pathology Vol. 7 Academic Press San Diego

    • Search Google Scholar
    • Export Citation
  • Young, G.K., Cooke, L.R., Kirk, W.W. & Tumbalam, P. 2004 Competitive selection of Phytophthora infestans in the US and Northern Ireland 10 Sept 2007 <http://www.plant.wageningen-ur.nl/expertise/Phytophthora/publicaties/EU_Proceedings/2004%20Proceedings%208th%20workshop%20EUnet%20PLB%20=Wiik.pdf> 271 275

    • Search Google Scholar
    • Export Citation

Contributor Notes

Current address: United States Department of Agriculture, Agricultural Research Service, Subarctic Agricultural Research Unit, Palmer, AK 99645-6629.

Department of Plant Pathology, Michigan State University, East Lansing, MI 48824.

Corresponding author. E-mail: douchesd@msu.edu.

  • View in gallery

    T-DNA region of pSPUD69. RGA2-PCR indicates the 8.59-kb BamHI fragment containing the RB gene ligated into the pBINPLUSARS base plasmid. This construct includes the NPTII gene for kanamycin resistance controlled by the ubiquitin (Ubi3) promoter (Pro) and terminator (Term). Natural promoter (2503-bp upstream) and termination sequences (2477-bp downstream) were used for RB. The region in the T-DNA where the RB primers anneal is designated by “PCR Product.”

  • View in gallery

    PCR amplification of RB and NPTII fragments from total potato DNA. The expected RB fragment is 213 bp. Lanes E69.01, E69.02, E69.03, E69.04, E69.05, E69.06, and E69.10 are putative transformants; lane MSE149-5Y, untransformed control; lane M, 100-bp DNA ladder.

  • View in gallery

    Southern hybridization of BamHI-digested total potato DNA with NPTII 700-bp fragment, 5-d exposure. Lanes E69.01, E69.03, E69.04, E69.05, and E69.06 are putative transformants; lane MSE149-5Y, untransformed control.

  • View in gallery

    Reverse-transcribed PCR of RB, NPTII, and EF1α. Expected fragments of RB, NPTII, and EF1α are 213, 267, and 400 bp, respectively. Lanes E69.01, E69.02, E69.03, E69.04, E69.05, E69.06, and E69.11 are putative potato transformants; lane MSE149-5Y, untransformed potato control; lane M, 1-kb DNA ladder.

  • Ballvora, A., Ercolano, M.R., Weiß, J., Meksem, K., Bormann, C.A., Oberhagemann, P., Salamini, F. & Gebhardt, C. 2002 The R1 gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/NBS/LRR class of plant resistance genes Plant J. 30 361 371

    • Search Google Scholar
    • Export Citation
  • Baker, K.M., Kirk, W.W., Stein, J.M. & Andresen, J.A. 2005 Climatic trends and potato late blight risk in the Upper Great Lakes region HortTechnology 15 510 518

    • Search Google Scholar
    • Export Citation
  • Bisognin, D.A., Douches, D.S., Buszka, L., Bryan, G. & Wang, D. 2005 Mapping late blight resistance in Solanum microdontum Bitter Crop Sci. 45 340 345

  • Bradshaw, J.E., Bryan, G.J., Lees, A.K., McLean, K. & Solomon-Blackburn, R.M. 2006 Mapping the R10 and R11 genes for resistance to late blight (Phytophthora infestans) present in the potato (Solanum tuberosum) R-gene differentials of Black Theor. Appl. Genet. 112 744 751

    • Search Google Scholar
    • Export Citation
  • Caten, C.E. & Jinks, J.L. 1968 Spontaneous variability of single isolates of Phytophthora infestans. I. Cultural variation Can. J. Bot. 46 329 348

  • Colton, L.M., Groza, H.I., Wielgus, S.M. & Jiang, J. 2006 Marker-assisted selection for the broad-spectrum potato late blight resistance conferred by gene RB derived from a wild potato species Crop Sci. 46 589 594

    • Search Google Scholar
    • Export Citation
  • Douches, D.S., Westedt, A.L., Zarka, K., Schroeter, B. & Grafius, E.J. 1998 Potato transformation to combine natural and engineered resistance for controlling tuber moth HortScience 33 1053 1056

    • Search Google Scholar
    • Export Citation
  • Doyle, J.J. & Doyle, J.L. 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue Phytochem. Bul. 19 11 15

  • Ewing, E.E., Šimko, I., Smart, C.D., Bonierbale, M.W., Mizubuti, E.S.G., May, G.D. & Fry, W.E. 2000 Genetic mapping from field tests of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii Mol. Breed. 6 26 36

    • Search Google Scholar
    • Export Citation
  • Felcher, K.J., Douches, D.S., Kirk, W.W., Hammerschmidt, R. & Li, W. 2003 Expression of a fungal glucose oxidase gene in three potato cultivars with different susceptibility to late blight (Phytophthora infestans Mont. de Bary) J. Amer. Soc. Hort. Sci. 128 238 245

    • Search Google Scholar
    • Export Citation
  • Garbarino, J.E. & Belknap, W.R. 1994 Isolation of a ubiquitin-ribosomal protein gene (ubi3) from potato and expression of its promoter in transgenic plants Plant Mol. Biol. 24 119 127

    • Search Google Scholar
    • Export Citation
  • Goodwin, S.B., Schneider, R.E. & Fry, W.E. 1995 Use of cellulose–acetate electrophoresis for rapid identification of allozyme genotypes of Phytophthora infestans Plant Dis. 79 1181 1185

    • Search Google Scholar
    • Export Citation
  • Guenthner, J.F., Wiese, M.V., Pavlista, A.D., Sieczka, J.B. & Wyman, J. 1999 Assessment of pesticide use in the US potato industry Amer. J. Potato Res. 76 25 29

    • Search Google Scholar
    • Export Citation
  • Hanneman, R.E. 1999 The reproductive biology of the potato and its implication for breeding Potato Res. 42S 283 312

  • Haynes, K.G., Lambert, D.H., Christ, B.J., Weingartner, D.P., Douches, D.S., Backlund, J.E., Secor, G., Fry, W. & Stevenson, W. 1998 Phenotypic stability of resistance to late blight in potato clones evaluated at eight sites in the United States Amer. J. Potato Res. 75 211 217

    • Search Google Scholar
    • Export Citation
  • Helgeson, J.P., Pohlman, J.D., Austin, S., Haberlach, G.T., Wielgus, S.M., Ronis, D., Zambolim, L., Tooley, P., McGrath, J.M., James, R.V. & Stevenson, W.R. 1998 Somatic hybrids between Solanum bulbocastanum and potato: a new source of resistance to late blight Theor. Appl. Genet. 96 738 742

    • Search Google Scholar
    • Export Citation
  • Hermsen, J.G.T. & Ramanna, M.S. 1973 Double-bridge hybrids of Solanum bulbocastanum and cultivars of Solanum tuberosum Euphytica 22 457 466

  • Hijmans, R.J. 2003 The effect of climate change on global potato production Amer. J. Potato Res. 80 271 280

  • Huang, S., van der Vossen, E.A.G., Kuang, H., Vleeshouwer, V.G.A.A., Zhang, N., Borm, T.J.A., van Eck, H.J., Baker, B., Jacobsen, E. & Visser, R.G.F. 2005 Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato Plant J. 42 251 261

    • Search Google Scholar
    • Export Citation
  • Ingham, D.J., Beer, S., Money, S. & Hansen, G. 2001 Quantitative real-time PCR assay for determining transgene copy number in transformed plants Biotechniques 31 132 141

    • Search Google Scholar
    • Export Citation
  • Kennard, W.K., Poetter, K., Dijkhuizen, A., Meglic, V., Staub, J.E. & Havey, M.J. 1994 Linkages among RFLP, RAPD, isozyme, disease resistance, and morphological markers in narrow and wide crosses of cucumber Theor. Appl. Genet. 89 42 48

    • Search Google Scholar
    • Export Citation
  • Kirk, W.W., Felcher, K.J., Douches, D.S., Coombs, J.M., Stein, J.M., Baker, K.M. & Hammerschmidt, R. 2001 Effect of host plant resistance and reduced rates and frequencies of fungicide application to control potato late blight Plant Dis. 85 1113 1118

    • Search Google Scholar
    • Export Citation
  • Kirk, W.W., Abu-El Samen, F.M., Muhinyuza, J.B., Hammerschmidt, R., Douches, D.S., Thill, C.A., Groza, H. & Thompson, A.L. 2005 Evaluation of potato late blight management utilizing host plant resistance and reduced rates and frequencies of fungicide applications Crop Prot. 24 961 970

    • Search Google Scholar
    • Export Citation
  • Kuhl, J.C., Hanneman, R.E. & Havey, M.J. 2001 Characterization and mapping of Rpi1, a late blight resistance locus from diploid (1EBN) Mexican Solanum pinnatisectum Mol. Genet. Genomics 265 977 985

    • Search Google Scholar
    • Export Citation
  • Malcolmson, J.F. 1969 Factors involved in resistance to blight (Phytophthora infestans (Mont.) de Bary) in potatoes and assessment of resistance using detached leaves Ann. Appl. Biol. 64 461 468

    • Search Google Scholar
    • Export Citation
  • Malcolmson, J.F. & Black, W. 1966 New R genes in Solanum demissum Lindl. and their complementary races of Phytophthora infestans (Mont.) de Bary Euphytica 15 199 203

    • Search Google Scholar
    • Export Citation
  • Martin, G.B., Bogdanove, A.J. & Sessa, G. 2003 Understanding the functions of plant disease resistance proteins Annu. Rev. Plant Biol. 54 23 61

  • Muller, K.O. & Black, W. 1952 Potato breeding for resistance to blight and virus diseases during the last hundred years Zt. Pflanzenzucht. 31 305 318

    • Search Google Scholar
    • Export Citation
  • Park, T.-H., Gros, J., Sikkema, A., Vleeshouwers, V.G.A.A., Muskens, M., Allefs, S., Jacobsen, E., Visser, R.G.F. & van der Vossen, E.A.G. 2005 The late blight resistance locus Rpi-blb3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on chromosome 4 of potato Mol. Plant Microbe Interact. 18 722 729

    • Search Google Scholar
    • Export Citation
  • Rauscher, G.M., Smart, C.D., Simko, I., Bonierbale, M., Mayton, H., Greenland, A. & Fry, W.E. 2006 Characterization and mapping of Rpi-ber, a novel potato late blight resistance gene from Solanum berthaultii Theor. Appl. Genet. 112 674 687

    • Search Google Scholar
    • Export Citation
  • Rommens, C.M., Humara, J.M., Ye, J.S., Yan, H., Richael, C., Zhang, L., Perry, R. & Swords, K. 2004 Crop improvement through modification of the plant's own genome Plant Physiol. 135 421 431

    • Search Google Scholar
    • Export Citation
  • Shaner, G. & Finney, R.E. 1977 The effect of nitrogen fertilization on the expression of slow-mildewing resistance in Knox wheat Phytopathology 67 1051 1056

    • Search Google Scholar
    • Export Citation
  • Sharma, K.K., Bhatnagar-Mathur, P. & Thorpe, T.A. 2005 Genetic transformation technology: status and problems In Vitro Cell. Dev. Biol. Plant 41 102 112

    • Search Google Scholar
    • Export Citation
  • Śliwka, J., Jakuczun, H., Lebecka, R., Marczewski, W., Gebhardt, C. & Zimnock-Guzowska, E. 2006 The novel, major locus Rpi-phu1 for late blight resistance maps to potato chromosome IX and is not correlated with long vegetation period Theor. Appl. Genet. 113 685 695

    • Search Google Scholar
    • Export Citation
  • Smilde, W.D., Brigneti, G., Jagger, L., Perkins, S. & Jones, J.D.G. 2005 Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1 Theor. Appl. Genet. 110 252 258

    • Search Google Scholar
    • Export Citation
  • Song, J., Bradeen, J.M., Naess, S.K., Raasch, J.A., Wielgus, S.M., Haberlach, G.T., Liu, J., Kuang, H., Austin-Phillips, S., Buell, C.R., Helgeson, J.P. & Jiang, J. 2003 Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight Proc. Natl. Acad. Sci. USA 100 9128 9133

    • Search Google Scholar
    • Export Citation
  • Stewart, H.E. 1990 Effect of plant age and inoculum concentration on expression of major gene resistance to Phytophthora infestans in detached potato leaflets Mycol. Res. 94 823 826

    • Search Google Scholar
    • Export Citation
  • Stewart, H.E., Bradshaw, J.E. & Pande, B. 2003 The effect of the presence of R-genes for resistance to late blight (Phytophthora infestans) of potato (Solanum tuberosum) on the underlying level of field resistance Plant Physiol. 52 193 198

    • Search Google Scholar
    • Export Citation
  • van der Vossen, E., Sikkema, A., Hekkert, B.L., Gros, J., Stevens, P., Muskens, M., Wouters, D., Pereira, A., Stiekema, W. & Allefs, S. 2003 An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato Plant J. 36 867 882

    • Search Google Scholar
    • Export Citation
  • van der Vossen, E.A.G., Gros, J., Sikkema, A., Muskens, M., Wouters, D., Wolters, P., Pereira, A. & Allefs, S. 2005 The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog conferring broad-spectrum late blight resistance in potato Plant J. 44 208 222

    • Search Google Scholar
    • Export Citation
  • Wastie, R.L. 1991 Breeding for resistance 193 224 Ingram D.S. & Williams P.H. Phytophthora infestans: the cause of late blight of potato. Advances in Plant Pathology Vol. 7 Academic Press San Diego

    • Search Google Scholar
    • Export Citation
  • Young, G.K., Cooke, L.R., Kirk, W.W. & Tumbalam, P. 2004 Competitive selection of Phytophthora infestans in the US and Northern Ireland 10 Sept 2007 <http://www.plant.wageningen-ur.nl/expertise/Phytophthora/publicaties/EU_Proceedings/2004%20Proceedings%208th%20workshop%20EUnet%20PLB%20=Wiik.pdf> 271 275

    • Search Google Scholar
    • Export Citation
All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 598 128 11
PDF Downloads 197 83 19