‘Liaolufeng’ is an interspecific hybrid walnut cultivar between Juglans mandshurica Maxim × Juglans regia L. The nutshell is 1.3 mm on average and the kernel is easy to remove. The average nut weight is 8.1 g, with the kernel contributing 43.2% of the nut weight. It is a laterally fruitful cultivar made up of 100% lateral buds.
In China, Persian walnut (Juglans regia L.) is one of the most cultivated nut tree species because of the nuts’ value. At the end of 2021, China had 7,454,935 ha cultivated walnut area, with 5,403,500 tonne nut production and 59,472 tonne oil production (Anonymous 2021). Walnut has great economic value as a precious nut and woody-oil plant. There is a trend that walnut is regarded as a substitute for soybean oil and makes up for the deficiency of the soybean, which is produced domestically to guarantee national grain and oil security. Manchurican walnut (Juglans mandshurica Maxim) is native to the north and northeast of China, as well as the far eastern areas of Russia. The nut and timber are both used. It is difficult to get the kernel from the nut and the kernel yield is ≈18%, so the utilization value of its wood is greater. Manchurican walnut is a so-called very cold-hardy species because of its natural distribution.
A walnut breeding program was initiated in the 1960s in China. The Chinese Academy of Forestry, Liaoning Institute of Economic Forestry (LIEF), Shandong Institute of Pomology, Henan Academy of Forestry, Xinjiang Academy of Forestry, Shaanxi Institute of Pomology, Beijing Fruit Institute of Pomology, and Shanxi Academy of Forestry were the pioneer institutions in that era. These organizations cooperated to solve the key problems and successfully screened 32 lateral bearing walnut cultivars. In the 32 lateral bearing walnut cultivars, Liaoning series, Zhonglin series, ‘Xiangling’, and ‘Wen 185’ are still widely cultivated (Ma et al. 2019). Subsequently, with gradually released new walnut cultivars and the breakthrough of asexual propagation technology, in the mid-1980s, the walnut industry in China entered the stage of varietal cultivation from the stage of the seedling. The walnut breeding program was started at LIEF in 1959 based on germplasm introduction, evaluation, and artificial hybridization. Eight lateral bearing cultivars and two terminal bearing cultivars have been released. All the released cultivars belong to J. regia L.
Liaoning province is the north bound of cultivated walnut (J. regia L.) due to low temperature in the winter and lack of cold hardiness cultivars. Besides, 1- to 2-year-old juvenile trees need protection in the winter. To extend the cultivated area, interspecific crossing between Manchurican walnut (J. mandshurica Maxim) and Persian walnut (J. regia L.) was carried out. The main objective was to use the cold-resistant trait of Manchurican walnut and the high kernel percentage of Persian walnut. Whereas in the F1 generation, the desired genotype with the parental characteristics could not be found. Sequentially, a back crossing between F1 and Persian walnut was conducted.
Origin
‘Liaolufeng’ originated from a controlled cross between J. regia cultivar Xiangling and germplasm ‘Yuanza 1’ in 2004. Xiangling, a released cultivar with a lateral bearing habit, 64% kernel, and five to nine leaflets (Wang et al. 1990), was used as the female parent because of its smooth nut surface, and thin nutshell. ‘Yuanza 1’ is an unreleased hybrid genotype (J. mandshurica Maxim × J. regia L.) with lateral bearing habit, 16.1% kernel, and nine to 13 leaflets. ‘Liaolufeng’ was preliminarily selected as a desirable genotype based on its lateral bearing habit, vigorous growth, dense and robust branches, medium kernel percentage, and easy to remove kernel. The first selection was during the 2007 season (April–November) and was identified as ‘2004 to 2007-1’. After 7 years of evaluation, ‘2004 to 2007-1’ was renamed ‘Liaolufeng’ and was granted new plant cultivar rights on Apr 25, 2024, by the National Forestry and Grassland Administration (certificate number 20240249).
Description and Performance
The cultivar is characterized by a rounded canopy with a half-spreading growth habit (Fig. 1A). The first female flower of a budding plant appears in the current year, and the male flower occurs in the second year after planting. They have odd-pinnately compound leaves with five to 13 leaflets, mostly nine leaflets (Fig. 1B). Female flower clusters generally consist of up to two to four flowers (Fig. 1C). This is a laterally fruitful cultivar made up of 100% lateral buds. The flowering is protandrous, with male and female flowers overlapping for 3 to 4 d. In the region of Dalian in Northeast China, leafing is in the middle of April, and leaf shedding occurs in early November. The pollen-shedding period is at the beginning of May, and the female flower blooming period is in mid-May. The harvest date is usually in the middle of September.
A view of ‘Liaolufeng’ tree, leaves, flower, and nuts. (A) Tree. (B) Leaves. (C) Female flowers. (D) Nuts.
Citation: HortScience 59, 9; 10.21273/HORTSCI17929-24
We evaluated the nut traits of ‘Liaoning 1’ according to “The National Standard of the People’s Republic of China: Guidelines for the Conduct of Tests for Distinctness, Uniformity and Stability—Juglans (Juglans L.)” (Pei et al. 2011). The nut is elliptical and grooved with a light color (Fig. 1D). The apex is convex, and the bottom is cuneate. The suture is convex and tight in combination. The nutshell is 1.3 mm on average and the inner fold degenerates, thus the kernel is easy to remove. The average nut weight is 8.1 g, with the kernel contributing 43.2% of the nut weight (Table 1). The color of the kernel is classified as light-yellow. In addition, the molecular fingerprint was established by simple repeat sequence method. The length of amplified bands of primer 1 (F: TGTGCTCTGATCTGCCTCC; R: GGGTGGGTGAAAAGTAGCAA), primer 2 (F: TGTAATTGGGGAATGTTGCA; R: TGGGAGACACAATGACGA), primer 3 (F: GTGGCGAAAGTTTATTTTTTGC; R: ACAAATGCACAGCAGCAAAC), and primer 4 (F: GCCTCTCCTCGTGCTCATTT; R: ACTCGCTACTTTTCAGGCCC) were 212/226, 181/181, 286/292, and 217/226, respectively.
Main characteristics of ‘Liaolufeng’ compared with Chinese main cultivated walnut cultivar as well as an American cultivar Chandler.
Feld trials for ‘Liaolufeng’ are being conducted at four locations in Liaoning province (Table 2). One-year-old grafted trees, which the rootstocks were Manchurican walnut, were arranged in a randomized complete block design, with each location containing three blocks and at least 10 trees for each block (Table 2). There was no natural distribution for Persian walnut in Changan, Xinxing, and Zhanggutai town in Liaoning province. The main goal was to assess the adaptability and fertility of ‘Liaolufeng’ in the cold region. At the planting site, natural distributed Manchurican walnuts were the pollinators for ‘Liaolufeng’. In the Paotai town, 1-year-old twigs of J. regia L. often suffered from low-temperature damage, while ‘Liaolufeng’ exhibited cold-hardy characteristics. In the Changan town, 2-year-old trees are surviving, germination and flowering were unaffected. So far, the performance of ‘Liaolufeng’ in the other two test sites cannot be concluded, because it has not experienced winter.
Field trials in four locations in Liaoning province.
Availability
Small amounts of hardwood scion are available for research purposes from the author. For commercial cultivation or propagation, a contract or an agreement should be negotiated between the grower(s) and LIEF. Of course, new plant cultivar rights of ‘Liaolufeng’ can also be transferred for compensation.
References Cited
Anonymous 2021. China forestry and grassland statistical year book. National Forestry and Grassland Administration. 41–43.
Ma QG, Le JX, Song XB, Zhou Y, Pei D. 2019. Fruit scientific research in New China in the past 70 years: Walnut. J Fruit Sci. 36(10):1360–1368. https://doi.org/10.13925/j.cnki.gsxb.Z10.
Pei D, Zhang JP, Zhou JR, Huang FJ, Wang H, Wang BQ, Yang WZ. 2011. The national standard of the People’s Republic of China: Guidelines for the conduct of tests for distinctness, uniformity and stability—Juglans (Juglans L.) (in Chinese). General Administration of Quality Supervision, Inspection and Quarantine of the P.R.C. and Standardization Administration of the P.R.C., Beijing, China.
Wang JY, Qi BX, Sun YG. 1990. Breeding of new walnut cultivars such as Xiangling (in Chinese). China Fruits. 1990(4):1–3 + 6. https://doi.org/10.16626/j.cnki.issn1000-8047.1990.04.001.