Advertisement
ASHS 2024 Annual Conference

 

A Single Nucleotide Polymorphism Unique to the Galanthum-CMS of Onion

Author:
Michael J. Havey Department of Horticulture, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA

Search for other papers by Michael J. Havey in
This Site
Google Scholar
Close

Abstract

Different sources of cytoplasmic male sterility (CMS) are used to produce hybrid onion seed. The most commonly used source of CMS in onion is S cytoplasm (S-CMS), and male fertility is restored by a dominant allele at the nuclear male-fertility restoration locus (Ms). Male-sterile plants possess S cytoplasm and have the homozygous recessive genotype at Ms; seed propagation of male-sterile plants is possible by crossing with a male-fertile maintainer plant or inbred possessing normal (N) male-fertile cytoplasm and the homozygous recessive at the Ms locus (N msms). Some commercially important onion populations possess S-CMS and high frequencies of the dominant Ms allele, eliminating the possibility to develop maintainer lines. An alloplasmic source of CMS (Gal-CMS) was developed by backcrossing the cytoplasm of Allium galanthum into the nuclear background of onion. The advantage of Gal-CMS is that the dominant allele at Ms does not restore male fertility, making this source of CMS useful for the development of male-sterile lines from populations possessing S cytoplasm and dominant allele(s) at Ms. In this research, a single nucleotide polymorphism unique to the cytoplasms of A. galanthum and Gal-CMS was identified, useful to distinguish Gal-CMS from other onion cytoplasms.

Hybrid onion (Allium cepa) seed is produced using systems of cytoplasmic male sterility (CMS). Two sources of CMS (R- and S-CMS) are the most commonly used commercially, and a third type (T-CMS) is used more rarely (Havey and Kim 2021). For S-CMS, male fertility is restored by a dominant allele at the nuclear male-fertility restoration locus Ms (Jones and Clarke 1943; Havey and Kim 2021; Kim et al. 2015). Kim (2014) reported that a dominant allele at Ms restored male fertility for T-CMS, disagreeing with previous research documenting that a dominant allele at Ms did not restore male fertility for T-CMS (Havey 1993) and that male-fertility restoration of T-CMS involves interactions among three nuclear loci (Schweisguth 1973). The likely explanation for this discrepancy is that the male-sterile cytoplasm evaluated by Kim et al. (2019) was R-CMS and not T-CMS. Seed propagation of R- and S-CMS is accomplished by crossing male-sterile plants with male-fertile (maintainer) plants that are homozygous recessive at Ms and possess the normal (N) male-fertile cytoplasm (Jones and Davis 1944; Kim 2014). However some commercially important onion populations, such as ‘Pukekohe Longkeeper’ and ‘Creamgold’, possess S cytoplasm and have high frequencies of the dominant Ms allele (Havey 1993), preventing the development of maintainer lines for R- and S-CMS. Havey (1999) developed and released an alloplasmic source of CMS (Gal-CMS) by backcrossing the cytoplasm of Allium galanthum into the nuclear background of onion. No anthers develop in the flowers of Gal-CMS plants and seed yield was not significantly different from S-cytoplasmic male-sterile lines (Havey 1999). When Gal-CMS plants were crossed with male plants homozygous dominant at the Ms locus, no male-fertile progenies were produced demonstrating that a dominant allele at Ms does not restore male fertility for Gal-CMS (Havey 1999). Therefore, Gal-CMS is useful for the development of male-sterile lines from populations possessing R- or S-CMS, and/or high frequencies of the dominant Ms allele. Havey and Kim (2021) reported on molecular markers distinguishing the N, R, S, and T cytoplasms of onion. In this research, I describe a single nucleotide polymorphism (SNP) in the chloroplast DNA that is unique to A. galanthum and Gal-CMS. With this SNP marker and those described by Havey and Kim (2021), important onion cytoplasms can be confidently classified.

Materials and Methods

Havey (1992) described the unique gain of an EcoRI restriction-enzyme site in the chloroplast genome of A. galanthum that was not found in N cytoplasm, T-CMS, or S-CMS of onion and not in closely related Allium vavilovii, Allium fistulosum, Allium altaicum, Allium oschaninii, Allium roylei, or Allium pskemense. Gal-CMS possesses this unique EcoRI site (Havey 1999). This polymorphism was detected by analysis of restriction fragment length polymorphisms using orchid chloroplast clones 13 through 16, which hybridize across the genomic region carrying chloroplast genes psaA, psaB, psbC, and psbD (Chase and Palmer 1989). These four genes are located from nucleotides 32,856 to 41,834 in the chloroplast genome of N-cytoplasmic onion (Genbank accession NC_024813.1). Sequences of the chloroplast DNAs of N- and S-cytoplasmic onion (Genbank accessions NC_024813.1 and KF728079.1, respectively; Von Kohn et al. 2013) and A. galanthum (NC_050981.1; Yusupov et al. 2021) were acquired from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/), and regions between psbM to rps4, which carry the coding regions for psaA, psaB, psaC, and psaD, were aligned (DNAMAN; Lynnon Biosoft, San Ramon, CA, USA), and inspected for a polymorphism producing an EcoRI site unique to A. galanthum (Havey 1992). Primers (Gal-CMS_F: 5′-GTAGCTACCGAGATAAATGCAGTTA and Gal-CMS_R: 5′-CAACCATCAGAAGAAGCAAATACAA) were designed to amplify across the genomic region that carried the unique EcoRI site in the chloroplast DNAs of A. galanthum (Havey 1992) and Gal-CMS (Havey 1999). Genomic DNAs were isolated from N- (B1750B) and S-cytoplasmic (B1750A) onion (Havey 1992), R-CMS (C5; Havey and Kim 2021), and T-CMS (RJ70A; Havey 1992) onions; Gal-CMS (Havey 1999); and USDA plant introduction (PI) 280091 of A. galanthum. PCR reactions contained 20 ng of genomic DNA, 1x PCR buffer with Mg2+ and Taq polymerase (Promega, Madison, WI, USA), and 10 µM of each primer in a final volume of 30 µL. PCR conditions were 94 °C for 3 min, 30 cycles of 94 °C for 30 s, 52 °C for 1 min, and 72 °C for 45 s), followed by a final extension at 72 °C for 15 min. Amplicons were column purified (Promega), digested with EcoRI, subjected to electrophoresis through 1%-agarose gel, and visualized using Gel-Green (Biotium, Fremont, CA, USA). Primers (5′- GAAGGTGACCAAGTTCATGCTCTCTCTCCTTTTTCTTTATTGTGGAATTA and 5′- GAAGGTCGGAGTCAACGGATTCTCTCTCCTTTTTCTTTATTGTGGAATTC; common primer: 5′-ATGAAAGATAACAAGTCAATCCAAACG-3′) were designed (Primer Picker software; LGC Genomics, Beverly, MA, USA) for genotyping of the T/G SNP using the kompetitive allele-specific PCR (KASP) platform (LGC Genomics), and 84 DNAs (Table 1) were evaluated to determine if the chloroplast SNP can be used to confidently identify Gal-CMS across diverse onion germplasm. Mixtures of genomic DNAs from N-cytoplasmic onion and Gal-CMS were prepared at 50:50, 75:25, and 90:10 (respectively) proportions with a final concentration of 20 ng·µL−1 and used for KASP genotyping to determine if the marker could detect the presence of Gal-CMS in populations of onion.

Table 1.

Accessions of onion, Allium galanthum, the Galanthum-CMS, and mixtures of genomic DNAs genotyped for the T/G single nucleotide polymorphisms distinguishing the galanthum cytoplasm from onion cytoplasms.

Table 1.
Table 1.

Results and Discussion

Chloroplast DNA sequences spanning the region across coding regions for psaA, psaB, psaC, and psaD from N-cytoplasmic and S-CMS onions and A. galanthum (NC_050981.1) were aligned and an EcoRI site unique to A. galanthum resulted from the change of T to G at position 32,258 in Genbank accession NC_050981.1 (from TAATTC to GAATTC to create the EcoRI restriction site). The chloroplast DNAs of A. galanthum, N cytoplasm, and S-CMS have the same EcoRI sites flanking the unique EcoRI site in A. galanthum and produce an 11,573-base pair (bp) fragment. The unique EcoRI site in A. galanthum digests this fragment into 4230- and 7343-bp fragments. Although CMS is commonly associated with the mitochondrial DNA (Kubo et al. 2011), maternal transmission of both the chloroplast and mitochondrial DNAs in the Alliums allows for polymorphisms in either genome to be used for cytoplasmic classifications.

The Gal-CMS-F and -R primers produced a 934-bp amplicon from the chloroplast DNA, which when digested with EcoR1 yielded 317-bp and 617-bp fragments for Gal-CMS and A. galanthum; chloroplast amplicons from N cytoplasm, R-CMS, S-CMS, and T-CMS were not digested (Fig. 1). Primers designed to distinguish the T/G SNP using the KASP assay revealed no evidence for the EcoRI site in 81 onion accessions (Table 1) and nucleotide G at this SNP was detected only in the chloroplast DNAs of Gal-CMS (614A, 811A, and 8152A) and A. galanthum (Fig. 2). The genomic region around the unique EcoRI site is relatively AT rich, and some fluorescence signal was likely due to self-complementarity within the selective T primer and placed accessions of Gal-CMS and A. galanthum between 0.3 and 0.4 on the x-axis (Fig. 2). Nevertheless Gal-CMS and A. galanthum were clearly separated from the onion populations (Fig. 2). Mixtures of genomic DNAs from N-cytoplasmic onion and Gal-CMS were placed between accessions with the galanthum cytoplasm and onion populations (Fig. 2); however it is possible that the unique EcoRI site could exist in onion populations at frequencies below 10%. With this unique polymorphism in the chloroplast DNA of Gal-CMS and markers described by Havey and Kim (2021), commercially important onion cytoplasms can be confidently categorized useful for characterization of male-sterile lines and development of hybrid onion cultivars.

Fig. 1.
Fig. 1.

Agarose gel of chloroplast amplicons [934 base pairs (bp)] digested with EcoRI from onion populations possessing normal (N) male-fertile cytoplasm; S, R, T, and galanthum (G) sources of cytoplasmic male sterility; and plant introduction (PI) 280091 of Allium galanthum. EcoRI digests of amplicons from Allium galanthum and G cytoplasm produced 317- and 617-bp fragments.

Citation: HortScience 59, 1; 10.21273/HORTSCI17412-23

Fig. 2.
Fig. 2.

Plot of relative fluorescence from KASP genotyping of the T (x-axis) vs. G (y-axis) single nucleotide polymorphism in the chloroplast DNAs of 81 accessions (Table 1) of onion (unlabeled blue circles); Allium galanthum PI 280091 and three onion populations (614A, 811A, and 8152A) possessing the Galanthum (Gal)-CMS (red circles); mixtures of genomic DNAs from normal male-fertile (N) cytoplasm of onion and Gal-CMS at ratios of 50:50, 75:25, and 90:10, respectively (green circles); and two controls with no DNA (black circles).

Citation: HortScience 59, 1; 10.21273/HORTSCI17412-23

References Cited

  • Chase MW, Palmer JD. 1989. Chloroplast DNA systematics of Lilioid monocots: Resources, feasibility, and an example from the Orchidaceae. Am J Bot. 76:17201730. https://www.jstor.org/stable/2444471.

    • Search Google Scholar
    • Export Citation
  • Havey MJ. 1992. Restriction enzyme analysis of the chloroplast and nuclear 45s ribosomal DNA of Allium sections Cepa and Phyllodolon. Plant Syst Evol. 183:1731. https://rdcu.be/cLpWs.

    • Search Google Scholar
    • Export Citation
  • Havey MJ. 1993. A putative donor of S cytoplasm and its distribution among open pollinated populations of onion. Theor Appl Genet. 86:128134. https://doi.org/10.1007/BF00223817.

    • Search Google Scholar
    • Export Citation
  • Havey MJ. 1999. Seed yield, floral morphology, and lack of male-fertility restoration of male-sterile onion (Allium cepa) populations possessing the cytoplasm of Allium galanthum. J Am Soc Hortic Sci. 124:626629. https://doi.org/10.21273/JASHS.124.6.626.

    • Search Google Scholar
    • Export Citation
  • Havey MJ, Kim S. 2021. Molecular marker characterization of commercially used cytoplasmic male sterilities in onion. J Am Soc Hortic Sci. 146:351355. https://doi.org/10.21273/JASHS05083-21.

    • Search Google Scholar
    • Export Citation
  • Jones HA, Clarke A. 1943. Inheritance of male sterility in the onion and the production of hybrid seed. Proc Am Soc Hortic Sci. 43:189194.

    • Search Google Scholar
    • Export Citation
  • Jones HA, Davis G. 1944. Inbreeding and heterosis and their relation to the development of new varieties of onions. USDA Tech. Bul. 874. Washington, DC.

  • Kim B, Yang T, Kim S. 2019. Identification of a gene responsible for cytoplasmic male-sterility in onions (Allium cepa L.) using comparative analysis of mitochondrial genome sequences of two recently diverged cytoplasms. Theor Appl Genet. 132:313322. https://doi.org/10.1007/s00122-018-3218-z.

    • Search Google Scholar
    • Export Citation
  • Kim S. 2014. A codominant molecular marker in linkage disequilibrium with a restorer-of-fertility gene (Ms) and its application in reevaluation of inheritance of fertility restoration in onions. Mol Breed. 34:769778. https://doi.org/10.1007/s11032-014-0073-8.

    • Search Google Scholar
    • Export Citation
  • Kim S, Kim C, Park M, Choi D. 2015. Identification of candidate genes associated with fertility restoration of cytoplasmic male sterility in onion (Allium cepa L.) using a combination of bulked segregant analysis and RNA seq. Theor Appl Genet. 128:22892299. https://doi.org/10.1007/s00122-015-2584-z.

    • Search Google Scholar
    • Export Citation
  • Kubo T, Kitazaki K, Matsunaga M, Kagami H, Mikami T. 2011. Male sterility-inducing mitochondrial genomes: How do they differ? Crit Rev Plant Sci. 30:378400. https://doi.org/10.1080/07352689.2011.587727.

    • Search Google Scholar
    • Export Citation
  • Schweisguth B. 1973. Etude d’un nouveau type de sterilite male chez l’oignon, Allium cepa L. Ann Amelior Plant. 23:221233.

  • Von Kohn C, Kiełkowska A, Havey MJ. 2013. Sequencing and annotation of the chloroplast DNAs of normal (N) male-fertile and male-sterile (S) cytoplasms of onion and single nucleotide polymorphisms distinguishing these cytoplasms. Genome. 56:737742. https://doi.org/10.1139/gen-2013-0182.

    • Search Google Scholar
    • Export Citation
  • Yusupov Z, Deng T, Volis S, Khassanov F, Makhmudjanov D, Tojibaev K, Sun H. 2021. Phylogenomics of Allium section Cepa (Amaryllidaceae) provides new insights on domestication of onion. Plant Divers. 43:102110. https://doi.org/10.1016/j.pld.2020.07.008.

    • Search Google Scholar
    • Export Citation
  • Fig. 1.

    Agarose gel of chloroplast amplicons [934 base pairs (bp)] digested with EcoRI from onion populations possessing normal (N) male-fertile cytoplasm; S, R, T, and galanthum (G) sources of cytoplasmic male sterility; and plant introduction (PI) 280091 of Allium galanthum. EcoRI digests of amplicons from Allium galanthum and G cytoplasm produced 317- and 617-bp fragments.

  • Fig. 2.

    Plot of relative fluorescence from KASP genotyping of the T (x-axis) vs. G (y-axis) single nucleotide polymorphism in the chloroplast DNAs of 81 accessions (Table 1) of onion (unlabeled blue circles); Allium galanthum PI 280091 and three onion populations (614A, 811A, and 8152A) possessing the Galanthum (Gal)-CMS (red circles); mixtures of genomic DNAs from normal male-fertile (N) cytoplasm of onion and Gal-CMS at ratios of 50:50, 75:25, and 90:10, respectively (green circles); and two controls with no DNA (black circles).

  • Chase MW, Palmer JD. 1989. Chloroplast DNA systematics of Lilioid monocots: Resources, feasibility, and an example from the Orchidaceae. Am J Bot. 76:17201730. https://www.jstor.org/stable/2444471.

    • Search Google Scholar
    • Export Citation
  • Havey MJ. 1992. Restriction enzyme analysis of the chloroplast and nuclear 45s ribosomal DNA of Allium sections Cepa and Phyllodolon. Plant Syst Evol. 183:1731. https://rdcu.be/cLpWs.

    • Search Google Scholar
    • Export Citation
  • Havey MJ. 1993. A putative donor of S cytoplasm and its distribution among open pollinated populations of onion. Theor Appl Genet. 86:128134. https://doi.org/10.1007/BF00223817.

    • Search Google Scholar
    • Export Citation
  • Havey MJ. 1999. Seed yield, floral morphology, and lack of male-fertility restoration of male-sterile onion (Allium cepa) populations possessing the cytoplasm of Allium galanthum. J Am Soc Hortic Sci. 124:626629. https://doi.org/10.21273/JASHS.124.6.626.

    • Search Google Scholar
    • Export Citation
  • Havey MJ, Kim S. 2021. Molecular marker characterization of commercially used cytoplasmic male sterilities in onion. J Am Soc Hortic Sci. 146:351355. https://doi.org/10.21273/JASHS05083-21.

    • Search Google Scholar
    • Export Citation
  • Jones HA, Clarke A. 1943. Inheritance of male sterility in the onion and the production of hybrid seed. Proc Am Soc Hortic Sci. 43:189194.

    • Search Google Scholar
    • Export Citation
  • Jones HA, Davis G. 1944. Inbreeding and heterosis and their relation to the development of new varieties of onions. USDA Tech. Bul. 874. Washington, DC.

  • Kim B, Yang T, Kim S. 2019. Identification of a gene responsible for cytoplasmic male-sterility in onions (Allium cepa L.) using comparative analysis of mitochondrial genome sequences of two recently diverged cytoplasms. Theor Appl Genet. 132:313322. https://doi.org/10.1007/s00122-018-3218-z.

    • Search Google Scholar
    • Export Citation
  • Kim S. 2014. A codominant molecular marker in linkage disequilibrium with a restorer-of-fertility gene (Ms) and its application in reevaluation of inheritance of fertility restoration in onions. Mol Breed. 34:769778. https://doi.org/10.1007/s11032-014-0073-8.

    • Search Google Scholar
    • Export Citation
  • Kim S, Kim C, Park M, Choi D. 2015. Identification of candidate genes associated with fertility restoration of cytoplasmic male sterility in onion (Allium cepa L.) using a combination of bulked segregant analysis and RNA seq. Theor Appl Genet. 128:22892299. https://doi.org/10.1007/s00122-015-2584-z.

    • Search Google Scholar
    • Export Citation
  • Kubo T, Kitazaki K, Matsunaga M, Kagami H, Mikami T. 2011. Male sterility-inducing mitochondrial genomes: How do they differ? Crit Rev Plant Sci. 30:378400. https://doi.org/10.1080/07352689.2011.587727.

    • Search Google Scholar
    • Export Citation
  • Schweisguth B. 1973. Etude d’un nouveau type de sterilite male chez l’oignon, Allium cepa L. Ann Amelior Plant. 23:221233.

  • Von Kohn C, Kiełkowska A, Havey MJ. 2013. Sequencing and annotation of the chloroplast DNAs of normal (N) male-fertile and male-sterile (S) cytoplasms of onion and single nucleotide polymorphisms distinguishing these cytoplasms. Genome. 56:737742. https://doi.org/10.1139/gen-2013-0182.

    • Search Google Scholar
    • Export Citation
  • Yusupov Z, Deng T, Volis S, Khassanov F, Makhmudjanov D, Tojibaev K, Sun H. 2021. Phylogenomics of Allium section Cepa (Amaryllidaceae) provides new insights on domestication of onion. Plant Divers. 43:102110. https://doi.org/10.1016/j.pld.2020.07.008.

    • Search Google Scholar
    • Export Citation
Michael J. Havey Department of Horticulture, University of Wisconsin, 1575 Linden Drive, Madison, WI 53706, USA

Search for other papers by Michael J. Havey in
Google Scholar
Close

Contributor Notes

M.J.H. is the corresponding author. E-mail: mjhavey@wisc.edu.

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 4112 4112 33
PDF Downloads 155 155 34
Save