Abstract
Monoic, dioic, and hermaphrodite flower types complicate spinach breeding and cultivar development. The availability of haploid plants will definitely accelerate spinach breeding; however, there are currently no reports in the literature about the use of tissue culture techniques to obtain spinach haploids. Therefore, in this study, pollination with irradiated pollen and anther culture methods were used to obtain haploid plants in spinach. For anther culture, three spinach varieties (Koto F1, Favorit F1, and Greenstar F1) and four different nutrient media were tested to obtain haploid embryos. Significant outcomes were not achieved from anther culture, and only two plants were obtained from all the experiments. Gynogenesis studies using irradiated pollen were performed with the same three spinach varieties and six gamma ray doses (100, 150, 200, 300, 400, and 500 Gy) from (cobalt60) Co60. Murashige and Skoog (MS) nutrient medium containing 1 mg·L−1 indoleacetic acid (IAA) was used for embryo germination. Current findings revealed that the varieties produced responded differently to the various doses of radiation. A total of 3414 embryos and 1710 plants were obtained from experiments carried out for 2 years. Considering the numbers of embryos and plants per 100 seeds, the Favorit F1 variety provided better results than the other two varieties. However, significantly different outcomes were not achieved with regard to irradiation doses. Embryos were observed at all doses tested. Flow cytometry analyses that were carried out on regenerated plants revealed whether the plants were diploid or doubled haploid, and molecular analyses revealed that diploids resulted from spontaneous chromosome doubling. The current findings offer significant results for spinach breeding using haploids.
Spinach (Spinacia oleracea L.), which belongs to the Chenopodiaceae family, is a cool-season vegetable. After China, the United States, and Japan, Turkey has the fourth place in spinach production (FAOSTAT, 2013).
In cultivar development, haploidization offers a great advantage by shortening the breeding cycle. Haploid plants can be obtained using various tissue culture techniques and full homozygosity can be achieved in quite a short time using these methods. Since the heterozygosity rate is high in open pollinated species, inbreeding should be performed for 10–12 generations to obtain homozygous lines. Such inbreeding should be performed for 5–7 generations in self-pollinated species and is impossible in dioic species. Dihaploidization allows development of homozygous lines in a single generation (Ellialtıoğlu et al., 2002). Anther culture is one of the techniques that are used widely to obtain haploid plants. The advantage of this technique over other methods to obtain in vitro haploid plants is the existence of thousands of microspores in an anther, and the possibility to obtain numerous haploid plants from an anther. Several factors affect embryo regeneration in anther culture. These factors include genotype, age of donor plant, pollen development stage, pretreatments made to buds or anthers, and composition of nutrient media. Successful outcomes were achieved with anther culture in pepper (Al Remi et al., 2014; Buyukalaca et al., 2004; Comlekcioglu et al., 2001; Ercan et al., 2006; Gémesné Juhász et al., 2001; Keleş et al., 2015; Niklas-Novak et al., 2012; Olszewska et al., 2013; Taşkin et al., 2011), eggplant (Başay and Ellialtıoğlu, 2013; Başay et al., 2011), and Brassica spp. (Achar, 2002; Arnison et al., 1990a, 1990b; Biddington and Robinson, 1990; Górecka et al., 2007; Phippen and Ockendon, 1990; Roulund et al., 1990).
Haploidization studies about pollination with irradiated pollen were initiated in the 1980s, and significant results were obtained for melon (Baktemur et al., 2013; Cuny et al., 1993; Godbole and Murthy, 2012a, 2012b; Gursoz et al., 1991) and squash (Berber, 2009; Kurtar et al., 2002, 2009), and promising outcomes were achieved for cucumber (Chun et al., 2006; Claveria et al., 2005; Faris et al., 1999; Nikolova and Alexandrova, 2001) and watermelon (Sarı et al., 1994; Taşkın et al., 2013). Factors such as genotype, environmental conditions, irradiation dose, size and shape of pollen grain, and thickness of pollen wall have significant impacts on the success of pollination with irradiated pollen. Gamma rays obtained from Co60 source are commonly used for pollen irradiation. When a flower is pollinated with irradiated pollen, the pollen’s vegetative nucleus starts karyokinesis and germination occurs on the stigma. This activity results in stimulation of the embryonary sac and then the ovule, syngenite or antipode cells start to divide. As a result of these divisions, irregular cell masses (callus) or embryos are formed. To provide the necessary stimulation to the embryonary sac, the pollen should not lose its vigor and ability to germinate and, at the same time, should be in a state in which it is unable to perform normal pollination. Thus, the suitability of irradiated pollen for haploidization is determined in great part by the dose of radiation to which the pollen is exposed (Ellialtıoğlu et al., 2002).
Spinach is a long-day plant and flowering starts when daylength exceeds 12 h. Germination is accelerated at dry and hot temperatures. Bolting usually is earlier in male plants than female plants. Both male and female flowers bloom at the same time; male flowers die earlier than female flowers. Female plants live longer than male plants and have larger and thicker leaves (Sneep, 1958). Earliness is a commonly desired characteristic in spinach and daylength requirement, growth rate, and the balance between growth and development play important roles in earliness. Spinach varieties differ in terms of earliness, and such variation is necessary for successful spinach culture under different growing conditions. Therefore, earliness is a significant trait for breeders (Parlevliet, 1967). Spinach breeding was initiated by Sneep (1958) for resistance to spinach mildew [Peronospora spinaciae (Mont.) de By] and mosaic virus (Cucumis virus 1). Breeding studies are difficult in spinach since monoic, dioic, and hermaphrodite flower patterns are encountered in the crop. Developing a haploidization protocol will greatly accelerate and make spinach breeding more widespread. Therefore, the aim of the present study was to develop an efficient method for haploid plant production in spinach. To reach this aim, anther culture (androgenesis) and pollination with irradiated pollen (parthenogenesis) techniques were used. The effects of the different methods on haploid plant acquisition were compared as were the effects of nutrient media, genotype, and irradiation dose. The primary objective of the present study was to set up a substructure for more economical, shorter, and more efficient production of high quality and quantities of spinach plants using modern breeding techniques.
Materials and Methods
Experiments were carried out at the Alata Horticultural Research Institute (Erdemli, Mersin, Turkey) and the Horticulture Department of Çukurova University (Adana, Turkey). Among the methods used for obtaining haploid plants, anther culture and pollination with irradiated pollen techniques were used to obtain haploid plants for breeding studies in spinach. Experiments were replicated for 2 years.
Plant materials.
Greenstar F1 (May Agro Seed Company, Bursa, Turkey), Favorit F1 (May Agro Seed Company), and Koto F1 (CN Seeds Ltd., Cambrigeshire, UK) spinach varieties were used as plant material. Greenstar F1 is a mid-early, high-yield variety. It has smooth, large, oval leaves with bright green color. Leaf tips are bumped, petioles are short, and leaf blades are large and fleshy. The variety is suitable for spring, autumn, and winter sowings. It is resistant to seven races of spinach downy mildew. It has either hermaphrodite flowers or is dioic. Favorit F1 is also a mid-early, high-yield variety with slightly wavy and dark green leaves. Leaf tips are again bumped, petioles are short, and leaf blades are large and fleshy. The variety is suitable for autumn and especially spring sowing. It is resistant to four races of spinach downy mildew. It has either hermaphrodite flowers or is dioic. Koto F1 is an early, high-yield variety. The leaves have pointed tips and are dark green color. The variety is suitable for autumn and especially spring sowings. It is dioic and resistant to two races of spinach downy mildew.
Anther culture.
Proper anther stages were identified for Koto F1, Greenstar F1, and Favorit F1 varieties before the initiation of anther culture procedures. For this purpose, male flower buds of different sizes were collected, classified based on their sizes, and numbered separately. Anthers were removed from flower buds using sterile forceps and scalpels, squashed over a microscope slide, and stained with acetocarmine. Because immature anthers including late-uninucleate or early-binucleate phase at the beginning of the first mitotic division are the best material for initiation of anther culture, flower buds at this stage were selected using a stereo microscope, and were used for anther culture. Flower buds were sterilized in a laminar flow cabinet using 20% sodium hypochlorite solution for 15 min and rinsed five times with sterile water. After sterilization, anthers were removed from flower buds with sterile forceps and scalpels, and were placed into 6-cm diameter sterile glass petri dishes containing nutrient medium. For anther culture experiments, four MS [Murashige and Skoog (1962)] nutrient media with different auxin and cytokinin levels were tested: 1) MS + 2 mg·L−1 naphthaleneacetic acid (NAA) + 0.5 mg·L−1 gibberellic acid (GA3); 2) MS + 4 mg·L−1 NAA + 0.5 mg·L−1 GA3; 3) MS + 2 mg·L−1 NAA + 1 mg·L−1 6-benzylaminopurine (BAP); and 4) MS + 4 mg·L−1 NAA + 1 mg·L−1 BAP.
Cultured anthers were incubated at 25 °C and 12:12 h dark:light photoperiod. The embryos obtained from anthers were removed with forceps and scalpels under the microscope and transferred to 15 cm long sterile glass culture tubes. Experiments were arranged in a complete randomized design with five replications.
Pollination with irradiated pollen.
Spinach is a long-day plant and flower bud initiation begins when the days are longer than 12 h. Therefore, with the initiation of flower bud formation, female flowers were closed with pollen-proof pouches to prevent open pollination. Male flower clusters were collected the day before anthesis, and were placed into glass petri dishes for irradiation. Male flowers were irradiated with gamma rays coming from a Co60 source. Irradiation doses were 100, 150, and 200 Gy in the first year and 200, 300, 400, and 500 Gy in the second year. After irradiation, the male flower clusters were kept at room temperature during the night for flower buds to open and for pollen anthesis. On the following day, isolated female plants were pollinated with irradiated pollen for 3 d, and then were closed with pouches until fruit set to prevent contamination (Fig. 1). In the following days, female plants were checked, and seeds reaching maturity were harvested. Flower inflorescences taken from the female plants were surface sterilized in 15% sodium hypochlorite solution for 15 min and rinsed using sterile distilled water five times. Embryos were identified using a stereo microscope and placed into sterile glass culture jars containing 0.1 mg·L−1 IAA MS nutrient medium. The cultures were incubated at 25 °C under 12 h dark–12 h light photoperiod. Since Favorit F1 and Greenstar F1 varieties had more hermaphrodite flowers, fewer plants were pollinated in these varieties than in Koto F1.
(A) Male spinach flowers in glass petri dishes prepared for irradiation, (B) pollination of female spinach plants with irradiated pollen, (C) closing female plants with pollen-proof pouches to prevent open pollination before pollination with irradiated pollen, (D) closing female plants after pollination with pollen-proof pouches to prevent contamination with different pollen until the fruit set.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A) Male spinach flowers in glass petri dishes prepared for irradiation, (B) pollination of female spinach plants with irradiated pollen, (C) closing female plants with pollen-proof pouches to prevent open pollination before pollination with irradiated pollen, (D) closing female plants after pollination with pollen-proof pouches to prevent contamination with different pollen until the fruit set.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A) Male spinach flowers in glass petri dishes prepared for irradiation, (B) pollination of female spinach plants with irradiated pollen, (C) closing female plants with pollen-proof pouches to prevent open pollination before pollination with irradiated pollen, (D) closing female plants after pollination with pollen-proof pouches to prevent contamination with different pollen until the fruit set.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
Ploidy analyses.
The ploidy level of plants was detected using a flow cytometer (Partec, Münster, Germany) and molecular analyses. The method employed in Keleş et al. (2015) was used for flow cytometry analyses. For molecular analyses, genomic DNA was extracted from young fresh leaves of donor plants and progenies using CTAB protocol (Doyle and Doyle, 1990). Amount of DNA was quantified on a Gene Quant pro RNA/DNA spectrophotometer (Amersham Pharmacia Biotech, Piscataway, NJ). A set of ten primer pairs (SO4, SO7, SO10, SO14, SO17, SO22, SO29, SO32, SO48, and SO51) amplifying spinach microsatellites and polymorphic between the parents was used in the present study. One of these previously described microsatellite primer pairs [SO29 (GT)5 and TAGGGTACTGTAGAGGAAGTCG] was used to test progenies (Groben and Wricke, 1998). Polymerase chain reaction (PCR) mixtures for microsatellite analysis were prepared as described by Khattak et al. (2006) with minor modifications and contained 50 ng template DNA, 0.2 μm of each primer, 0.2 mm of each dNTP, 1× reaction buffer (Thermo Fisher Scientific, MA), and 1U Taq Polymerase (Thermo Fisher Scientific) in a volume of 10 μL. PCR products were electrophoresed using metaphor agarose in 1× TAE buffer, stained with ethidium bromide, and visualized by a gel image system (Kodak Gel Logic 200; Eastman Kodak Company, Rochester, NY).
Results
Anther culture studies.
For anther culture, three different varieties were tested in four different nutrient media with five replications for 2 years, and no results were achieved in the first year of experiments.
Promising outcomes were achieved from the anther culture studies in the second year. Callus formation was observed in medium number 2 of Koto F1 variety (Fig. 2) and a plant was formed from that callus (Table 1). This plant was placed into a glass culture tube containing hormone-free MS medium. The plant was monitored at certain intervals, propagated, and transferred into tubes. Callus formation was also observed in the first, second, fourth, and fifth replications of number 3 nutrient medium, and the first, fourth, and fifth replications of number 4 nutrient medium of Koto F1 variety. Callus formation was also observed in Favorit F1 and Greenstar F1 varieties [first and second replications of number 3 nutrient medium of Favorit F1 and third, fourth, and fifth replications of Greenstar F1 variety (Tables 2 and 3)].
(A, B) Callus formation from anther, (C, D) different types of regeneration in anther culture.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A, B) Callus formation from anther, (C, D) different types of regeneration in anther culture.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A, B) Callus formation from anther, (C, D) different types of regeneration in anther culture.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
Results for anther culture of Koto F1 variety (second year).
Results for anther culture of Favorit F1 variety (second year).
Results for anther culture of Greenstar F1 variety (second year).
Pollination with irradiated pollen.
As there was no previous work in spinach using pollination with irradiated pollen, doses of 100, 150, and 200 Gy were tested in the first year, and doses of 200, 300, 400, and 500 Gy were tested in the second year. Gamma rays coming from Co60 were used as irradiation source, and the results are provided in Tables 4 and 5. Considering the results of the first year, it was observed that 150-Gy dose yielded better outcomes for Koto F1 variety with regard to embryo formation (number of embryos/100 seeds), and 100-Gy dose yielded better outcome with regard to regeneration to plant (number of plants/100 seeds). Among the varieties used in this study, only Koto F1 exhibited completely dioic sexual reproduction. Since both hermaphrodite and dioic flowers were observed in Favorit F1 and Greenstar F1, some of the pollinated plants were not taken into consideration. Therefore, in Favorit F1, the plants pollinated with pollen irradiated at 100 Gy were not taken into consideration, only the 150- and 200-Gy doses were compared, with the 200-Gy dose yielding better results with regard to embryo formation and plant regeneration. Only one dioic plant was obtained for Greenstar F1 variety irradiated with 200 Gy, and the high results were observed (50.00% embryos/100 seeds, 33.33% plants/100 seeds) in this plant (Table 4). However, successful outcomes were also achieved with 150-Gy dose (Fig. 3).
Number of embryos and plants obtained through pollination with irradiated pollen and 100 seed ratios (first year).
Number of embryos and plants obtained through pollination with irradiated pollen and 100 seed ratios (second year).
(A) Female spinach flowers pollinated with irradiated pollens, (B–D) in vitro plants obtained from pollination with irradiated pollen technique.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A) Female spinach flowers pollinated with irradiated pollens, (B–D) in vitro plants obtained from pollination with irradiated pollen technique.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A) Female spinach flowers pollinated with irradiated pollens, (B–D) in vitro plants obtained from pollination with irradiated pollen technique.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
Experiments were conducted with 200-, 300-, 400-, and 500-Gy doses in the second year. In the Koto F1 variety, the 300-Gy dose yielded successful outcomes with regard to both embryo formation and plant regeneration. In Favorit F1, the 400-Gy dose yielded better results for embryo formation, whereas 300 Gy was better for regeneration into plant. In Greenstar F1 variety, 300 Gy gave better results for embryo formation and 500 Gy for regeneration into plant. However, only one plant was obtained with the 500-Gy dose in Greenstar F1 variety, and a similar result was observed from the 200-Gy dose of Favorit F1. Despite such deficiencies, the 300-Gy dose yielded superior outcomes in the second year.
Considering the averages for the irradiation doses of the first year, the 100-Gy dose yielded 465 embryos from 3839 seeds, and 156 of these embryos were transformed into plants (12.11 embryo/100 seed and 4.06 plant/100 seed). For the 150-Gy dose, 823 embryos and 172 plants were obtained from 5341 seeds (15.41 embryos/100 seeds and 3.22 plants/100 seeds). For the 200-Gy dose, 315 embryos and 52 plants were obtained from 2988 seeds (10.54 embryos/100 seeds and 1.74 plants/100 seeds). Thus, in the first year, the 150-Gy dose yielded better results with regard to embryo formation. Considering the averages for the irradiation doses of the second year, the 200-Gy dose gave 476 embryos and 160 plants from 6416 seeds (7.42 embryos/100 seeds and 2.49 plants/100 seeds). For the 300-Gy dose, 561 embryos and 200 plants were obtained from 6064 seeds (9.25 embryos/100 seeds and 3.30 plants/100 seeds). For the 400-Gy dose, 679 embryos and 254 plants were obtained from 9103 seeds (7.46 embryos/100 seeds and 2.79 plants/100 seeds). For the 500-Gy dose, 95 embryos and 40 plants were obtained (8.84 embryos/100 seeds and 3.72 plants/100 seeds).
When the experimental results of the 2 years were assessed with regard to varieties, it was observed that better results were achieved for the Favorit F1 variety in both years. In the first year, 312 embryos and 29 plants were obtained from 975 seeds, with ratios of 32 embryos/100 seeds and 2.97 plants/100 seeds. In the second year, 223 embryos and 63 plants were obtained from 1389 seeds with ratios of 16.05 embryos/100 seeds and 4.53 plants/100 seeds. For the Koto F1 variety, 999 embryos and 296 plants were obtained from 9921 seeds in the first year (10.07 embryos/100 seeds and 3.72 plants/100 seeds); 967 embryos and 413 plants were obtained from 13056 seeds in the second year (7.41 embryos/100 seeds and 3.16 plants/100 seeds). For the Greenstar F1 variety, 292 embryos and 55 plants were obtained from 1272 seeds in the first year (22.95 embryos/100 seeds and 4.32 plants/100 seeds); and 621 embryos and 178 plants were obtained from 8212 seeds in the second year (7.56 embryos/100 seeds and 2.17 plants/100 seeds).
Different embryo types were observed including those which were solid inside, slightly solid inside, liquid inside, almost empty inside, and empty inside. In all three varieties, empty inside and almost empty inside embryos were more common at high irradiation doses (300, 400, and 500 Gy). The plants with such embryo types exhibited slower growth than the other embryo types.
The significance of haploid plants, as well as the fully homozygotic lines of double haploids originating from them, has been increasing for numerous plant species in modern breeding programs (Nowaczyk and Kisiala, 2006). Flow cytometer was used to determine if the regenerated plants were haploid, doubled haploid, or diploid. In this study, all plants obtained from anther culture and irradiated pollen and screened via flow cytometer, were diploid or double haploid (Fig. 4). Flow cytometry results had no peak for haploid plants. Simple sequence repeat (SSR) markers from the spinach genome were used to control homozygosity or heterozygosity of the plants to determine if they were normal diploids or doubled haploids. A set of ten primer pairs (SO4, SO7, SO10, SO14, SO17, SO22, SO29, SO32, SO48, and SO51) were used, which yielded two bands for heterozygotes. Of these primer pairs, nine were monomorphic and one (SO29) was heterozygous for Koto variety. Then, 66 Koto progenies were screened using SO29 SSR primer pairs. Of these 66 Koto progenies, 23 yielded one band like the homozygote, and therefore should be spontaneous doubled haploids (Fig. 5; Table 6).
(A) Flow cytometer results for donor plant of Koto variety, (B) flow cytometer results for donor plant of Koto progeny.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A) Flow cytometer results for donor plant of Koto variety, (B) flow cytometer results for donor plant of Koto progeny.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A) Flow cytometer results for donor plant of Koto variety, (B) flow cytometer results for donor plant of Koto progeny.
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A, B) Electrophoresis results obtained from SO29 simple sequence repeat primer pairs (order and description of samples in Table 6).
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A, B) Electrophoresis results obtained from SO29 simple sequence repeat primer pairs (order and description of samples in Table 6).
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
(A, B) Electrophoresis results obtained from SO29 simple sequence repeat primer pairs (order and description of samples in Table 6).
Citation: HortScience 51, 6; 10.21273/HORTSCI.51.6.742
Discussion
Monoic, dioic, and hermaphrodite flowering in spinach make breeding difficult. Therefore, most companies abstain from spinach breeding. However, optimization of a proper haploidization technique will definitely accelerate spinach breeding. In this study, anther culture and pollination with irradiated pollen haploidization techniques were investigated, and a basis was established for the generation of haploids for spinach breeding. To the best of our knowledge, there are no previous studies on haploidization using in vitro techniques in spinach. Thus, current findings will enlighten future research in spinach breeding.
Although no results were achieved through anther culture in the first year, some successful outcomes were obtained in the second year. During the second year, callus development and embryo formation were observed in all three varieties tested, and a plant was obtained in the Koto F1 variety. Such developments experienced in the second year indicated that further nutrient medium and genotype experiments might reveal successful combinations for anther culture procedures in spinach.
Better results were achieved from pollination with irradiated pollen than from anther culture, and the average number of embryos per 100 seeds even reached the 50s in irradiation treatments. All genotypes and irradiation doses yielded embryo formation and regeneration into plants. Although experimental results did not clearly indicate the optimum irradiation dose, the haploidization response of spinach to pollination with irradiated pollen was considered as a remarkable outcome. With the use of this method, 3414 embryos and 1710 plants were obtained. Slow growth and yellowing were identified as the greatest problems after the regeneration into plant. Pretests revealed that BAP and FeEDHA supplementation to nutrient media may reduce the incidence of such problems.
Van Geyt et al. (1987) carried out a study on sugar beet (Beta vulgaris L.), which is in the same family as spinach, to obtain haploid plants, and obtained more than 2.2% haploid plants with an ovule culture method. The researchers also reviewed previous studies and indicated that successful outcomes could not be achieved in sugar beet with anther culture and pollination with irradiated pollen techniques. Bossoutrot and Hosemans (1985) were able to obtain two haploid plants from 1000 ovules in sugar beet. Doctrinal et al. (1989), Lux et al. (1990), Baranski (1996), and Gürel et al. (2000) carried out studies on sugar beet and investigated the effects of nutrient medium, genotype, and pretreatments on gynogenesis. As was seen in those studies, commercially available haploid plants were not obtained in sugar beet through tissue culture techniques. Even if haploid plants were obtained, the same response would not be observed in different species despite belonging to the same family. In other words, a protocol successfully implemented in sugar beet may be unsuccessful in spinach. For instance, although anther culture is routine in pepper and eggplant of the Solanaceae family, success has not yet been achieved in tomato, another member of the same family. Similarly, although successful outcomes are achieved through pollination with irradiated pollen in melon and squash of the Cucurbitaceae family, commercial success has not yet been achieved in watermelon of the same family.
Another interesting outcome of the present study was the fact that embryos obtained through pollination with irradiated pollen did not have endosperm, and had different shapes. In other words, although they appeared to be haploid, they were diploid according to flow cytometry results. Such a case suggests that spontaneous chromosome doubling was occurring as is commonly observed in pepper and cabbage. Spontaneous diploids were also reported by Keleş et al. (2015) in pepper (over 50%), by Gémesné Juhász et al. (2001) in sweet pepper (29.8%), by Gu et al. (2003) in Brassica rapa ssp. chinensis (over 70%), by Mohammadi et al. (2007) in maize (7%), and by Vanous (2011) again in maize varying with genotypes (2.8% to 46%). El-Hennawy et al. (2011) indicated varying spontaneous doubling in wheat with genotypes, Stober and Hess (1997) reported such rates in German spring wheat as between 15% to 44%, and Barnabas (2003) reported the rates in central and eastern European winter wheat as between 25% to 68%. Kahrizi and Mohammadi (2009) reported spontaneous doubling rates in wheat as between 65% to 76%, and Mirzaei et al. (2011) reported the rates in barley as between 63% to 72%. All these findings are from anther culture procedures carried out on different plant types. Spontaneous doubling was not reported in plants obtained through pollination with irradiated pollen. However, this does not necessarily mean that such cases will not exist, since there are limited studies about pollination with irradiated pollen method. It was surmised according to SSR marker analysis that single-band individuals might come from homozygote double haploid plants and double-band individuals might come from somatic cells. Therefore, further molecular studies should be carried out to identify if the chromosome doubling occurred through spontaneous doubling or if plants were already diploid from the beginning.
Literature Cited
Achar, P.N. 2002 A study of factors affecting embryo yields from anther culture of cabbage Plant Cell. Tiss. Org. 69 183 188
Al Remi, F., Taşkın, H., Sönmez, K., Büyükalaca, S. & Ellialtıoğlu, Ş. 2014 Effect of genotype and nutrient medium on anther culture of pepper (Capsicum annuum L) Turk. J. Agr. Natural Sci. 1 108 116
Arnison, P.G., Donaldson, P., Jackson, A., Semple, C. & Keller, W. 1990a Genotype-specific response of cultured broccoli (Brassica oleracea var. italica) anthers to cytokinins Plant Cell. Tiss. Org. 20 217 222
Arnison, P.G., Donaldson, P., Ho, L.C.C. & Keller, W.A. 1990b The influence of various physical parameters on anther culture of broccoli (Brassica oleracea var. italica) Plant Cell. Tiss. Org. 20 147 155
Baktemur, G., Taşkın, H. & Büyükalaca, S. 2013 Comparison of different methods for separation of haploid embryo induced through irradiated pollen and their economic analysis in melon (Cucumis melo var. inodorus) ScientificWorld J. 2013 529502
Baranski, R. 1996 In vitro gynogenesis in red beet (Beta vulgaris L.): Effects of ovule culture conditions Acta Soc. Bot. Pol. 65 57 60
Barnabas, B. 2003 Protocol for producing doubled haploid plants from anther culture of wheat (Triticum aestivum L.), p. 65–70. In: M. Maluszynski, K.J. Kasha, B.P. Forster, and I. Szarejko (eds.). Doubled haploid production in crop plants, A manual. Kluwer Academic Publishers, Dordrecht, The Netherlands.
Başay, S., Şeniz, V. & Ellialtıoğlu, Ş. 2011 Obtaining dihaploid lines by using anther culture in the different eggplant cultivars J. Food Agr. Environ. 9 188 190
Başay, S. & Ellialtıoğlu, Ş. 2013 Effect of genotypical factors on the effectiveness of anther culture in eggplant (Solanum melongena L.) Turk. J. Biol. 37 499 505
Berber, M. 2009 Production of haploids in naked seed pumpkins (Cucurbita pepo L. var. styriaca) by pollination with irradiated pollen. Çukurova Univ., Adana, MSc Diss
Biddington, N.L. & Robinson, H.T. 1990 Variations in response to high temperature treatments in anther culture of Brussels sprouts Plant Cell. Tiss. Org. 22 48 54
Bossoutrot, D. & Hosemans, D. 1985 Gynogenesis in Beta vulgaris L.: From in vitro culture of unpollinated ovules to the production of doubled haploid plants in soil Plant Cell Rep. 4 300 303
Buyukalaca, S., Comlekcioglu, N., Abak, K., Ekbic, E. & Kilic, N. 2004 Effect of silver nitrate and donor plant growing conditions on production of pepper (Capsicum annuum L.) haploid embryos via anther culture Eur. J. Hort. Sci. 69 206 209
Chun, L., Jin-Feng, C., Chun-Tao, Q., Xiao-Qing, Z. & Yong-Bing, Z. 2006 Studies on induction of haploid cucumbers by irradiated pollen pollination and their characterization Sci. Agr. Sinica 39 1428 1436
Claveria, E., Garcia-Mas, J. & Dolcet-Sanjuan, R. 2005 Optimization of cucumber doubled haploid line production using in vitro rescue of in vivo induced parthenogenic embryos J. Amer. Soc. Hort. Sci. 130 555 560
Comlekcioglu, N., Buyukalaca, S. & Abak, K. 2001 Effect of silver nitrate on haploid embryo induction by anther culture in pepper (Capsicum annuum), p. 133–135. In: K. Abak, S. Büyükalaca, Y. Daşgan (eds.). Proc. of the XI EUCARPIA Mtg. on Genetics and Breeding of Capsicum and Eggplant. Eucarpia
Cuny, F., Grotte, M., Dumas de Vaulx, R. & Rieu, A. 1993 Effects of gamma irradiation of pollen on parthenogenetic haploid production in muskmelon (Cucumis melo L.) Environ. Exp. Bot. 33 301 312
Doctrinal, M., Sangwan, R.S. & Sangwan-Norreel, B.S. 1989 In vitro gynogenesis in Beta vulgaris L.: Effects of plant growth regulators, temperature, genotypes and season Plant Cell. Tiss. Org. 17 1 12
Doyle, J.J. & Doyle, J.L. 1990 Isolation of plant DNA from fresh tissue Focus 12 13 15
El-Hennawy, M.A., Abdalla, A.F., Shafey, S.A. & Al-Ashkar, I.M. 2011 Production of doubled haploid wheat lines (Triticum aestivum L.) using anther culture technique Ann. Agr. Sci. 56 63 72
Ellialtıoğlu, Ş., Sarı, N. & Abak, K. 2002 Haploid plant production, p. 137–189. In: M. Babaoğlu, E. Gürel, and S. Özcan (eds.). Plant biotechnology, tissue culture and its application. Vol. 1. Selçuk Univ. Press, Konya, Turkey
Ercan, N., Sensoy, F.A. & Sensoy, A.S. 2006 Influence of growing season and donor plant age on anther culture response of some pepper cultivars (Capsicum annuum L.) Scientia Hort. 110 16 20
FAOSTAT 2013 Food and Agriculture Organization of the United Nations. 23 Oct. 2014. <http://faostat.fao.org/site/567/default.aspx#ancor>
Faris, N.M., Nikolova, V. & Niemirowicz-Szczytt, K. 1999 The effect of gamma irradiation dose on cucumber (Cucumis sativus L.) haploid embryo production Acta Physiol. Plant. 21 391 396
Gémesné Juhász, A., Petus, M., Venczel, G., Zatykó, L., Gyulai, G. & Cséplö, M. 2001 Genetic variability of anther donor versus spontaneous doubled haploid descendents and colchicine induced doubled haploid sweet pepper (Capsicum annuum L.) lines Acta Hort. 560 149 152
Godbole, M.G. & Murthy, H.N. 2012a Parthenogenetic haploid plants using gamma irradiated pollen in snapmelon (Cucumis melo var. momordica) Plant Cell. Tiss. Org. 109 167 170
Godbole, M.G. & Murthy, H.N. 2012b In vitro production of haploids via parthenogenesis in culinary melon (Cucumis melo var. acidulous) Indian J. Biotechnol. 11 495 497
Górecka, K., Krzyżanowska, D. & Kowalska, U. 2007 Regeneration and evaluation of androgenetic plants of head cabbage (Brassica oleracea var. capitata L.) Veg. Crops Res. Bul. 67 5 15
Groben, R. & Wricke, G. 1998 Occurrence of microsatellites in spinach sequences from computer databases and development of polymorphic SSR markers Plant Breed. 117 271 274
Gu, H.H., Zhou, W.J. & Hagberg, P. 2003 High frequency spontaneous production of doubled haploid plants in microspore cultures of Brassica rapa ssp. chinensis Euphytica 134 239 245
Gürel, S., Gürel, E. & Kaya, Z. 2000 Doubled haploid plant production from unpollinated ovules of sugar beet (Beta vulgaris L.) Plant Cell Rep. 19 1155 1159
Gursoz, N., Abak, K., Pitrat, M. & Dumas de Vaulx, R. 1991 Obtention of haploid plants induced by irradiated pollen in watermelon (Citrullus lanatus) Rep. Cucurbit Genet. Coop. 14 109 110
Kahrizi, D. & Mohammadi, R. 2009 Study of androgenesis and spontaneous chromosome doubling in barley (Hordeum vulgare L.) genotypes using isolated microspore culture Acta Agron. Hung. 57 155 164
Keleş, D., Pınar, H., Ata, A., Taşkın, H., Yıldız, S. & Büyükalaca, S. 2015 Effect of pepper types on obtaining spontaneous doubled haploid plants via anther culture HortScience 50 1 6
Khattak, J.Z.K., Torp, A.M. & Andersen, S.B. 2006 A genetic linkage map of Spinacia oleracea and localization of a sex determination locus Euphytica 148 311 318
Kurtar, E.S., Sarı, N. & Abak, K. 2002 Obtention of haploid embryos and plants through irradiated pollen technique in squash (Cucurbita pepo L.) Euphytica 127 335 344
Kurtar, E.S., Balkaya, A., Ozbakir, M. & Ofluoglu, T. 2009 Induction of haploid embryo and plant regeneration via irradiated pollen technique in pumpkin (Cucurbita moschata Duchesne ex Poir) Afr. J. Biotechnol. 8 5944 5951
Lux, H., Herrmann, L. & Wetzel, C. 1990 Production of haploid sugar beet (Beta vulgaris L.) by culturing unpollinated ovules Plant Breed. 104 177 183
Mirzaei, M., Kahrizi, D. & Rezaeizad, A. 2011 Androgenesis and spontaneous chromosome doubling in Hordeum vulgare L. Researches of the First International Conference. Babylon and Razı Universities
Mohammadi, P.P., Moieni, A. & Jalali-Javaran, M. 2007 Colchicine induced embryogenesis and doubled haploid production in maize (Zea mays L.) anther culture Iranian J. Biotechnol. 5 140 146
Murashige, T. & Skoog, F. 1962 A revised medium for rapid growth and bioassay with tobacco tissue cultures Physiol. Plant. 15 473 497
Niklas-Novak, A., Olszewska, D., Kisiala, A. & Nowaczyk, P. 2012 Study of individual plant responsiveness in anther cultures of selected pepper (Capsicum spp.) genotypes Folia Hort. 24 141 146
Nikolova, V. & Alexandrova, M. 2001 Gynogenesis in a dihaploid line of cucumber (Cucumis sativus L.) Cucur. Genet. Coop. Rep. 24 20 21
Nowaczyk, P. & Kisiala, A. 2006 Effect of selected factors on the effectiveness of Capsicum annuum L. anther culture J. Appl. Genet. 47 113 117
Olszewska, D., Kisiala, A., Niklas-Nowak, A. & Nowaczyk, P. 2013 Study of in vitro anther culture in selected genotypes of genus Capsicum Turk. J. Biol. 38 118 124
Parlevliet, J.E. 1967 The influence of external factors on the growth and development of spinach cultivars (Spinacia oleracea L.) Meded. LandbHogesch, Wageningen 67 1 75
Phippen, C. & Ockendon, D.J. 1990 Genotype, plant, bud size and media factors affecting anther culture of cauliflowers (Brassica oleracea var. botrytis) Theor. Appl. Genet. 79 33 38
Roulund, N., Hansted, L., Andersen, S.B. & Farestveit, B. 1990 Effect of genotype, environment and carbohydrate on anther culture response in head cabbage (Brassica oleracea L. convar. capitata (L.) Alef.) Euphytica 49 237 242
Sarı, N., Abak, K., Pitrat, M., Rode, J.C. & Dumas de Vaulx, R. 1994 Induction of parthenogenetic haploid embryos after pollination by irradiated pollen in watermelon HortScience 29 1189 1190
Sneep, J. 1958 The breeding of hybrid varieties and the production of hybrid seed in spinach Euphytica 7 119 122
Stober, A. & Hess, D. 1997 Spike pre-treatment, anther culture conditions, and anther culture response of 17 German varieties of spring wheat (Triticum aestivum L.) Plant Breed. 116 443 447
Taşkın, H., Yücel, N.K., Baktemur, G., Çömlekçioğlu, S. & Büyükalaca, S. 2013 Effects of different genotypes and gamma ray doses on haploidization with irradiated pollen technique in watermelon (Citrullus lanatus L.) Can. J. Plant Sci. 93 1165 1168
Taşkin, H., Büyükalaca, S., Keleş, D. & Ekbiç, E. 2011 Induction of microspore-derived embryos by anther culture in selected pepper genotypes Afr. J. Biotechnol. 10 17116 17121
Van Geyt, J.P.C., Spechmann, G.J. & D’Hallium, K. 1987 In vitro induction of haploid plants from unpollinated ovules and ovaries of the sugar beet (Beta vulgaris L.) Theor. Appl. Genet. 73 920 925
Vanous, A.E. 2011 Optimization of doubled haploid production in maize (Zea mays L.). Iowa State Univ., IA, MSc Diss
