The genus Paphiopedilum Pfitzer, popularly known as slipper orchids because of the resemblance of the pouch-shaped lip to a lady's slipper (Cribb, 1998; Sheehan and Sheehan, 1994), have captured the interest of many orchid growers and hobbyists, and Paphiopedilum are one of the most popular and rare orchid genera being sold and exhibited today. Their unique shape, variety of colors, and extended flowering period make them distinctive to the orchid family. The genus is comprised of ≈77 species found in southern India, Nepal, Bhutan, northeast India, and Burma across to southern China, Southeast Asia, the Malay Archipelago, the Philippines, New Guinea, and the Solomon Islands. A total of 27 species of Paphiopedilum have been reported to be present in China (Cribb, 1998; Liu et al., 2009a, 2009b). Wild populations are under increasing pressure from overcollection and habitat destruction, and all species are listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), Appendix I, thus restricting trade of these plants.

Like many other slipper orchids, P. concolor (Batem.) Pfitzer, a native of southeast Burma, southwest China (Yunan, Guizhou, and Guangxi provinces), Thailand, Laos, Cambodia, and Vietnam, has become a popular ornamental plant since its discovery in 1865 (Cribb, 1998; Liu et al., 2009a). This popularity as well as general habitat destruction and overcollection, has contributed to a drastic decline in the number and range of the wi1d populations. Determining the genetic diversity of the remaining wild plants is a critical step in developing effective conservation strategies for P. concolor as well as many other species. Microsatellites are ideal markers for characterizing of population structure (Schlotterer, 1998) and have previously been used for the study of endangered orchids (Rodrigues and Kumar, 2009). In the current investigation, we focused on microsatellite isolation in P. concolor to obtain polymorphic markers for investigation of population genetics.

A microsatellite-enhanced genomic library was constructed using an optimized affinity capture technique described by Fleischer and Loew (1995) and Xia et al. (2006). A P. concolor plant was sampled from Yunnan province, China. Genomic DNA was extracted from fresh leaf tissue by using the cetyltrimethyl ammonium bromide method (Doyle, 1991). We constructed an enriched partial genomic library following a modified protocol of fast isolation by amplified fragment length polymorphism of sequences containing repeats (FIASCO) (Zane et al., 2002). Approximately 250 ng of genomic DNA was digested into 200 to 1000 bp by a restriction enzyme MboI (TaKaRa, Japan) and the resulting fragments were ligated to MboI linkers (SAULA: 5′GCGGTACCCGGGAAGCTTGG3′; SAULB: 5′GATCCCAAGCTTCCCGGGTACCGC3′) with T4 DNA ligase (TaKaRa) and incubated overnight at 16 °C. The digestion–ligation mixture was subsequently diluted 10 times, and 2 μL was used for polymerase chain reaction (PCR) amplification with SAULA oligonucleotide as the primer. PCR products were hybridized to two single-strand biotinylated microsatellite oligonucleotides [(CA)₁₂-biotion and (GA)₁₂-biotin]. These hybrids were captured by streptavidin-coated magnetic beads (BioMag Nuclease-Free Streptavidin; Qiagen). The magnetic beads were eluted and the resulting DNA solution served as a template for PCR using SAULA olignucleotide as the primer. The amplification product was directly ligated into the pGEM-T plasmid vector (Promega, Madison, WI) and transformed into Escherichia coli. DH5α competent cells (TaKaRa) were plated onto LB agar medium (Bacto-Tryptone 10 g·L⁻¹, Bacto-yeast extract 5 g·L⁻¹, NaCl 5 g·L⁻¹, agar 6 g·L⁻¹). Recombinant plasmids were identified through blue–white screening. For further identification of the clones containing microsatellites, colony PCR was performed with a primer combination of (CA)₁₂ or (GA)₁₂ and M13 universal primers. The insert fragments of 124 positive clones were sequenced. Among the 97 (78.23%) positive clones containing microsatellites with five or more repeat units, 63 were selected for primer development. Amplification primers were designed using PRIMER 5.0. To control for polymorphism of the identified microsatellite loci, 30 individual P. concolor were used from three natural populations in Baoshan and Wenshan in Yunnan province and Pengxiang in Guangxi province and planted in a greenhouse in South China Botanical Garden, Chinese Academy of Sciences. PCR amplification was performed in 10-μL reaction mixtures consisting of ≈50 ng of template DNA, 50 mm of KCl, 20 mm of Tris-HCl (8.0), 1.5 mm of MgCl₂, 0.2 mm of each dNTP, 0.2 μM of each primer, and 1 U of Taq DNA polymerase (TaKaRa). The reaction mixture was subjected to PCR amplification in a PTC-100 (MJ) with the following cycling profile: 5 min at 95 °C followed by 35 cycles of 40 s at 94 °C, 50 s at the primer specific annealing temperature (Table 1), 1 min at 72 °C, and a final prolonged extension of 10 min at 72 °C. PCR products were separated on 5% denaturing polyacrylamide gels using a 100-bp DNA ladder standard (Promega) as the reference and visualized by silver staining. The microsatellite alleles were sized by using LABIMAGE Version 2.7.1.

Table 1.

Characteristics of 10 microsatellite loci for P. concolor

View Table

Approximately 47 of the 63 primer pairs were successfully amplified containing 10 polymorphic loci and 37 monomorphic loci. Variability of the microsatellite loci was evaluated using POPGENE32 (Yeh et al., 1997). Deviation from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium were tested with GENEPOP Version 3.4 (Raymond and Rousset, 1995) and Rice's method of sequential Bonferroni correction (Rice, 1989).

Genotyping of all individuals revealed moderately high polymorphism with three to 12 alleles per locus and an across-loci average of 6.4 alleles per locus. The expected heterozygosity ranged from 0.200 to 0.800, and the observed heterozygosity varied from 0.544 to 0.827 (Table 1), respectively. No evidence of linkage disequilibrium was found between any loci pairs, indicating physical independence of the 10 loci. Four loci, PCCA100, PCGA2, PCGA40, and PCGA49, exhibited significant deviation from HWE after Bonferroni correction (adjusted P value = 0.001; Table 1) as a result of heterozygote deficiency (positive F_IS values), which could be caused by inbreeding in this species.

We also tested for cross-species amplification of the 10 P. concolor microsatellite primers in two closely related species, P. bellatulum (Rchb.f.) Pfitzer and P. wenshanense Z.J.Liu & J.Yong Zhang (Liu et al., 2009a, 2009b) using the same PCR conditions as previously described. Seven positive amplifications occurred across all tested species; the remaining three (PCCA88, PCCA100, and PCCA176) resulted in weak amplifications.

Data generated in this study strongly indicate that these newly developed microsatellite loci are potentially useful markers for investigating both population genetics and conservation biology of the congenetic Paphiopedilum species. The results have also great potential value for identification of hybrids of this slipper orchid, for analyzing genetic structure of native populations, and for learning the genetic background of the artificial growing individuals for restoring wild populations of this slipper orchid.