Marker-assisted Selection for Coupling Phase Resistance to Tomato spotted wilt virus and Phytophthora infestans (Late Blight) in Tomato

in HortScience
View More View Less
  • 1 Department of Horticulture and Crop Science, The Ohio State University, Ohio Agricultural Research and Development Center, 1680 Madison Avenue, Wooster, OH 44691
  • | 2 Vegetable Division, Horticulture Research Centre, Bangladesh Agricultural Research Institute, Joydebpur, Gazipur-1701, Bangladesh
  • | 3 Department of Horticultural Science, North Carolina State University, Mountain Horticultural Crops Research and Extension Center, 455 Research Drive, Mills River, NC 28759
  • | 4 Department of Horticultural Science, North Carolina State University, Mountain Horticultural Crops Research and Extension Center, 455 Research Drive, Mills River, NC 28759
  • | 5 Department of Horticulture and Crop Science, The Ohio State University, Ohio Agricultural Research and Development Center, 1680 Madison Avenue, Wooster, OH 44691
  • | 6 Department of Plant and Wildlife Sciences, Brigham Young University, 287 WIDB, Provo, UT 84602

Tomato spotted wilt virus (TSWV) and Phytophthora infestans (late blight) in tomato (Solanum lycopersicum) have a worldwide distribution and are known to cause substantial disease damage. Sw-5 (derived from S. peruvianum) and Ph-3 (derived from S. pimpinellifolium) are, respectively, TSWV and late blight resistance genes. These two genes are linked (within 5 cM on several maps) in repulsion phase near the telomere of the long arm on chromosome 9. The tomato lines NC592 (Ph-3) and NC946 (Sw-5) were crossed to develop an F2 population and subsequent inbred generations. Marker-assisted selection (MAS) using three polymerase chain reaction-based codominant markers (TG328, TG591, and SCAR421) was used in F2 progeny with the goal of selecting for homozygous coupling-phase recombinant lines. From 1152 F2 plants, 11 were identified with potential recombination events between Ph-3 and Sw-5; of those, three were male sterile (ms-10). F3 progeny were generated from the remaining eight F2 recombinants, and resistance to both pathogens, or Ph-3 and Sw-5 in coupling phase, was confirmed in three of those. Recombination was suppressed fivefold in our F2 population to 1.11 cM between genes when compared with published maps of the same region. However, MAS was an efficient tool for selecting the desirable recombination events for these two pathogen resistance genes.

Abstract

Tomato spotted wilt virus (TSWV) and Phytophthora infestans (late blight) in tomato (Solanum lycopersicum) have a worldwide distribution and are known to cause substantial disease damage. Sw-5 (derived from S. peruvianum) and Ph-3 (derived from S. pimpinellifolium) are, respectively, TSWV and late blight resistance genes. These two genes are linked (within 5 cM on several maps) in repulsion phase near the telomere of the long arm on chromosome 9. The tomato lines NC592 (Ph-3) and NC946 (Sw-5) were crossed to develop an F2 population and subsequent inbred generations. Marker-assisted selection (MAS) using three polymerase chain reaction-based codominant markers (TG328, TG591, and SCAR421) was used in F2 progeny with the goal of selecting for homozygous coupling-phase recombinant lines. From 1152 F2 plants, 11 were identified with potential recombination events between Ph-3 and Sw-5; of those, three were male sterile (ms-10). F3 progeny were generated from the remaining eight F2 recombinants, and resistance to both pathogens, or Ph-3 and Sw-5 in coupling phase, was confirmed in three of those. Recombination was suppressed fivefold in our F2 population to 1.11 cM between genes when compared with published maps of the same region. However, MAS was an efficient tool for selecting the desirable recombination events for these two pathogen resistance genes.

Although cultivar development for multiple pathogen resistance in tomato (Solanum lycopersicum L.) is a desirable goal, the process is often challenging. This is largely the result of the need for large-scale screening and the lack of available resistance genes in a cultivated genetic background. It is often further complicated by linkage drag of unacceptable characteristics tightly linked with resistance, emergence of new disease pathogens or new races of existing pathogens, and the necessity of selecting for resistance to multiple pathogens (Yang and Francis, 2005). Marker-assisted selection (MAS) offers an opportunity to overcome some of the problems associated with phenotypic selection and facilitates combining multiple resistance genes.

Tomato spotted wilt virus (TSWV) and Phytophthora infestans (Mont.) de Bary (late blight) are responsible for substantial tomato crop losses worldwide (Foolad et al., 2008; Fry and Goodwin, 1997; Kim and Mutschler, 2005, 2006; Mumford et al., 1996; Roselló et al., 1996). Several resistance genes have been identified for both pathogens; however, two genes have been found to be especially valuable for their broad level of resistance to each of these pathogens (Foolad et al., 2008; Gordillo et al., 2008). Both genes, Sw-5 for resistance to TSWV and Ph-3 for resistance to P. infestans, were originally introgressed from wild relatives and confer high levels of pathogen resistance.

The TSWV resistance gene Sw-5 was introgressed from S. peruvianum (previously Lycopersicon peruvianum Mill.; accession unknown) (Stevens, 1964; Stevens et al., 1992; van Zijl et al., 1986). This gene confers resistance to the Tospovirus species TSWV, Groundnut ringspot virus, and Tomato chlorotic spot virus (Bioteux et al., 1993; Stevens et al., 1992; van Zijl et al., 1986). The P. infestans resistance gene Ph-3, derived from S. pimpinellifolium L. [formerly L. pimpinellifolium (Jusl). Mill. accession L3707], is of incomplete dominant inheritance; however, it confers strong resistance to a spectrum of P. infestans isolates, even when plants are heterozygous for this gene (AVRDC, 1998; Black et al., 1996a, 1996b; Chunwongse et al., 1998, 2002; Foolad et al., 2008; Gardner and Panthee, 2010).

Sw-5 and Ph-3 are tightly linked to the restriction fragment length polymorphism markers CT220 and TG591A, respectively (Brommonschenkel et al., 2000; Chunwongse et al., 1998, 2002; Folkertsma et al., 1999; Stevens et al., 1995). These two markers are near the telomere of the long arm of chromosome 9 and are separated by 5 cM or less on the EXPEN 2000 and the EXPEN 1992 tomato maps (http://solgenomics.net; Tanksley et al., 1992). Because these two genes originate from different wild relatives of tomato, they are naturally linked in the repulsion phase. The phase and short genetic distance between them provide a potential challenge to recombining them into a coupling phase, a step needed for developing homozygous parent lines for hybrids and open-pollinated cultivars. An additional challenge is that a number of tomato breeding programs and studies have identified recombination suppression in chromosomal regions derived from wild relatives (Canady et al., 2005, 2006; Ganal and Tanksley, 1996; Liharska et al., 1996).

Because both TSWV and P. infestans can be devastating pathogens, the development of tomato germplasm homozygous for Sw-5 and Ph-3 enables the possibility of pyramiding Ph-1, Ph-2, and Ph-3 with Sw-5 and Sw-7 for broader resistance than is presently available (Dockter et al., 2009; Foolad et al., 2008; Gordillo et al., 2008; Price et al., 2007; Scott et al., 2005). Therefore, the development of lines homozygous for both genes was the objective of this research. To overcome recombination suppression and avoid phenotypic screening of many individuals, we used MAS to quickly screen a large F2 population for plants with potential crossovers placing Sw-5 and Ph-3 in the coupling phase. The selfed progeny of these recombinants were subsequently screened for resistance to each disease. Furthermore, we used the literature in combination with our data and the available tomato genome sequence to lay the foundation for cloning Ph-3.

Materials and Methods

Plant material.

An F2 population, segregating for Ph-3 and Sw-5, was derived from NC 946-1(2004)-11 × NC 0592-8-10 and was used to identify coupling phase Ph-3/Sw-5 recombinants. NC 0592-8-10, designated as NC592, is a Ph-3/Ph-3 inbred line and was derived from NC 0483 × NC 25P (Gardner and Panthee, 2010), whereas NC 946-1(2004)-11, designated as NC946, is a Sw-5/Sw-5 inbred line derived from NC EBR-7 × ‘Amelia’. A total of 1152 F2 plants were subjected to DNA marker analysis to identify recombinants between Ph-3 and Sw-5. Eleven recombinant F2 plants were identified with the genes putatively in the coupling phase and were self-pollinated to create F3 progeny. Because three were male sterile [ms-10 gene derived from the NC592 parent (Gardner, 2000; Gardner and Panthee, 2010)], eight F2 recombinants produced seed in the greenhouse. For each of these eight recombinants, we transplanted 40 individual F3 plants for evaluation in the field in Wooster, OH, in 2008. The F3 plants were also genotyped by molecular markers to identify 65 individuals potentially homozygous for Sw-5 and Ph-3. These plants were visually inspected and 30 were retained and self-pollinated based on desirable characteristics of vine type, heavy fruit load, uniform fruit color, fruit shape, and fruit size. Among the 30 selected F3 plants were at least three representatives from each of the eight original F2 recombinants (Table 1). Additionally, F5 progeny were created for confirmation of the original F2 recombinants 08-5401, 08-5403, and 08-5408.

Table 1.

Genotype (F2 and F3) and phenotype (F4 and F5) of individuals selected as coupling phase recombinants for Ph-3 (P. infestans) and Sw-5 (TSWV) resistance genes in tomato.

Table 1.

Evaluation of disease resistance.

TSWV maintenance and evaluation of resistant tomatoes was preformed as previously described (Canady et al., 2001; Gordillo et al., 2008; Stevens et al., 1992). Briefly, mechanical inoculation of the “HR-1” isolate was performed at least twice, 1 week apart, with controls [near isogenic tomato lines 89R (Sw-5/Sw-5; resistant) and 89S (Sw-5+/Sw-5+; susceptible)] included. HR-1 is an isolate derived from TSWV-infected field tomatoes in Hawaii. This isolate readily infects Sw-5+/Sw-5+ lines but does not infect Sw-5/Sw-5 or Sw-5/Sw-5+ genotypes. Plants with stunted growth, necrotic patches, or chlorotic ringspots were considered infected and scored as homozygous-susceptible (Sw-5+/Sw-5+). Seven to 20 individual F4 or F5 progeny were rated for resistance to TSWV as R or S and the percentage of susceptible (S) progenies was calculated. Two separate evaluations were performed in 2008 and 2010 using progeny from different F3 recombinants (Table 1).

Phytophthora infestans resistance was evaluated using a detached leaf assay and field tests. Isolate Ph2-OC, originating in tomato in North Carolina, overcomes Ph-2, but not Ph-3, and was maintained on live tomato plants. Lines NC 2CELBR (Ph-3/Ph-3; resistant) and NC 30P (Ph-3+/Ph-3+; susceptible) were used as controls. Fully expanded young leaves with five leaflets were excised from each of six plants per line using a single-edge razor blade from greenhouse-grown plants. Each leaf was placed into 120 mL distilled water in a snap seal plastic sample container with a 1-cm hole in the center of the lid. Containers were placed in a clear plastic box and hand sprayed to atomize a sporangia suspension (5000 sporangia/mL of distilled water) of Ph2-OC until the upper surface of each excised tomato leaf was completely covered. The boxes were closed and placed in an incubator at 20/16 °C for 12-h photoperiods. Leaves of each line were evaluated after 1 week using a score from 1 to 5 (1 for no lesions and 5 for completely covered with lesions or dead). Fifteen resistant lines identified from the detached leaf tests were planted in the field in the summer in two locations (Mills River and Waynesville, NC) under natural inoculum without any fungicide spray. Individual plants were scored from 0 to 5 (0 for no lesions and 5 for completely covered with lesions or dead).

Molecular marker genotyping.

Marker-assisted selection for Ph-3 and Sw-5 was accomplished using previously identified markers. Ph-3 was indirectly selected using the cleaved amplified polymorphic sequences (CAPS) markers TG328 and TG591 (M. Mutschler, personal communication). TG328 was detected using the primers (5′ to 3′) TG328F (GGTGATCTGCTTATAGACTTGGG) and TG328R (AAGGTCTAAAGAAGGCTGGTGC) and the restriction endonuclease BstNI. For TG591, the primers TG591F (AAGGCAAAGGAAGTTGGAGGTCA) and TG591R (AGAGGTTGCAACTCGTGGATTGAG) were used with AciI. Fragment sizes for TG328:BstNI were 500 bp (undigested) for the NC946 allele (T) and a 260/240-bp doublet for the NC592 allele (P). For the TG591:AciI digest, a multiple band phenotype was observed with the diagnostic polymorphism as a 150-bp fragment in NC946 (T) and a 160-bp fragment in NC592 (P).

To indirectly select for Sw-5, the sequenced characterized amplified region (SCAR) marker SCAR421 was used (Anfoka et al., 2006; Folkertsma et al., 1999; Stevens et al., 1996). SCAR421 amplified a 940-bp fragment in NC946 (T allele associated with Sw-5) and a 920-bp fragment in NC592 (P allele). Each individual within all populations evaluated with markers was initially genotyped and then selections were subsequently resampled and genotyped for confirmation.

To determine marker genotypes, genomic DNA was isolated in 96-well format following the modified CTAB method described by Kabelka et al. (2002) and subjected to polymerase chain reaction (PCR). Conditions for PCR reactions were 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 1.5 mm MgCl2, 50 μM of each dNTP, 0.1 μM of each forward and reverse primers, 20 ng of template DNA, and 1 unit of Taq DNA polymerase in a total volume of 10 to 20 μL. PCR amplification was performed using the cycling parameters of 30 s at 94 °C followed by 35 cycles of 20 s at 94 °C, 20 s at 55 °C, and 2 min at 72 °C followed by an extended incubation for 7 min at 72 °C. For CAPS markers, PCR amplicons were digested with the appropriate restriction endonuclease by adding 0.08 to 0.16 units of enzyme in 1× digestion buffer for each microliter of PCR product. Markers were visualized as size polymorphisms by agarose gel electrophoresis. Genotype frequencies for all markers were tested for deviation from expected segregation ratios by a χ2 goodness-of-fit test. Map distances between markers were calculated from the genotypic data of the original F2 population using JoinMap 3.0 (Van Ooijen and Voorrips, 2001). The markers were first grouped with a LOD of at least 10.0 and then the Kosambi mapping function was used to calculate the distance between markers in centiMorgans.

Results and Discussion

Selection of coupling phase recombinants using molecular markers.

A total of 1152 F2 plants were genotyped with TG328, TG591, and SCAR421 to identify 24 recombinants with 11 potentially having both resistances in coupling phase. Of these 11, eight produced F3 progeny (Table 1). The observed recombination events suggested a marker order of TG328, TG591, and SCAR421, consistent with previous maps and the physical order of the markers on BAC clones for chromosome 9 (Folkertsma et al., 1999). However, recombination distances of 0.33 cM between TG328 and TG591 and 0.78 cM between TG591 and SCAR421 suggest that recombination was suppressed between the S. peruvianum introgression (Sw-5) and the S. pimpinellifolium introgression (Ph-3) segments. In contrast, markers TG328 and TG591 are separated by 1 cM on the reference maps, whereas TG591 and SCAR421 (physically linked to CT220) are separated by 5.0 cM (Pillen et al., 1996; Tanksley et al., 1992) on the EXPEN 2000 map (http://www.solgenomics.net). Suppression of recombination is not unexpected in introgressions (Canady et al., 2005, 2006; Ganal and Tanksley, 1996; Liharska et al., 1996; Zamir and Tadmor, 1986).

Confirmation of resistances of F4 and F5 progeny.

For phenotypic confirmation, F3 and F5 progenies derived from each of the eight F2 coupling phase recombinants were challenged with P. infestans and TSWV. Progeny derived from 08-5401, 08-5404, and 08-5406 were significantly more susceptible to P. infestans than the resistant control. These progeny were also more resistant than susceptible controls; thus, we considered the phenotype ambiguous. Progeny from at least five of the F2 recombinants were unambiguously resistant to P. infestans. The progeny derived from 08-5402 appeared to segregate or show less than complete resistance to TSWV, whereas families derived from 08-5407 were fully susceptible. Families derived from 08-5403, 08-5405, and 08-5408 showed resistance to both pathogens (Table 1).

Genetic and physical order of the Ph-3 and Sw-5 genes.

An insufficient number of recombinant plants were identified to accurately position Ph-3 and Sw-5 relative to the molecular markers. The small number of recombinants and the ambiguous scoring of progeny derived from 08-5401, 08-5404, and 08-5406 for P. infestans resistance and 08-5402 for TSWV resistance further complicate our ability to accurately place the genes based on phenotyping only the coupling phase recombinants. Complete susceptibility to TSWV in progeny derived from 08-5407 strongly suggest linkage to SCAR421 was broken and that the Sw-5 resistance gene cannot be distal to this marker and probably lies in the interval between TG591 and SCAR421. The most likely position of Ph-3 is either the interval between TG328 and TG591 or distal to TG328.

The marker and resistance gene order suggested by recombinant progeny is consistent with the physical organization of the Sw-5 region of chromosome 9. Sequence data for bacterial artificial chromosomes (BACs) are available from Folkertsma et al. (1999) and from the international tomato genome sequencing effort. Marker TG328 is not yet anchored to a BAC. Marker TG591 is anchored to a 110,571-bp BAC clone, C09Hba0165P17 (GenBank EF647605; GI: 149930469). BAC clones containing Sw-5 family members Sw-5a (AY007366) and Sw-5c (AY007367) have been sequenced (Folkertsma et al., 1999). These include a 35,250-bp BAC containing the Sw-5 locus (GenBank AY007366; GI: 15418708) with significant homology to the 114,526-bp BAC, C09HBa109D11 (GenBank EF647603; GI: 149930467), and the 113,581-bp BAC clone C09Hba226D21 (GenBank EU139072; GI: 157649058). The 3′ end of C09Hba109D11 overlaps with the 5′ end of clone C09Hba226D21 suggesting a possible contiguous sequence. CT202 is anchored to a 95,676-bp BAC Hba0059I05 (SGN only, because this sequence was not yet deposited in GenBank at the time of this writing). The marker SCAR421 is physically linked to CT202 within ≈65 Kb (Folkertsma et al., 1999). The 5′ region of BAC Hba0059I05 has homology to C09Hba109D11 and homology to the Sw-5a protein. The 3′ end of BAC Hba0059I05 95676 has no significant homology to sequences in the NCBI database. The fact that this region contains homology to a number of resistance gene families, including Sw-5 family members (C09Hba109D11, C09Hba226D21, and Hba0059I05), the Tm-2a gene (C09Hba0165P17), and homologs to Phytophthora resistance genes (C09Hba0165P17) from the wild potato S. venturii (Foster et al., 2009; Lanfermeijer et al., 2003; Pel et al., 2009), suggests that caution should be used in defining contiguous sequences until more complete data are available. Based on available genetic and physical data, it appears that the members of the Sw-5 family responsible for TSWV resistance lie within the interval defined by TG591 and CT202 with SCAR421 distal (Brommonschenkel et al., 2000; Folkertsma et al., 1999; this article). Our data suggest that the likely position for Ph-3 is between TG328 and TG591. The occurrence of several resistance gene homologs on BAC clones containing TG591 suggests possible candidates. Based on the length of the sequenced BAC clones, it appears that the position of Ph-3 is likely to be physically separated from Sw-5 by over 100,000 bp despite the low genetic distance separating the loci in the NC592 × NC946 cross.

Literature Cited

  • Anfoka, G.H., Abhary, M. & Stevens, M.R. 2006 Occurrence of Tomato spotted wilt virus (TSWV) in Jordan EPPO Bulletin 36 517 522

  • AVRDC 1998 AVRDC Report 1997 Asian Vegetable Research and Development Center Shanhua, Tainan, Taiwan

  • Bioteux, L.S., Nagata, T. & Giordano, L.B. 1993 Field resistance of tomato Lycopersicon esculentum lines to tomato spotted wilt disease Rep. Tomato Genet. Coop. 43 7 9

    • Search Google Scholar
    • Export Citation
  • Black, L.L., Wang, T.C., Hanson, P.M. & Chen, J.T. 1996a Late blight resistance in four wild tomato accessions, effectiveness in diverse locations and inheritance of resistance Phytopathology 86 S24

    • Search Google Scholar
    • Export Citation
  • Black, L.L., Wang, T.C. & Huang, Y.H. AVRDC 1996b New sources of late blight resistance identified in wild tomatoes Tropical Vegetable Information Service Newsletter 1 15 17

    • Search Google Scholar
    • Export Citation
  • Brommonschenkel, S.H., Frary, A. & Tanksley, S.D. 2000 The broad-spectrum tospovirus resistance gene Sw-5 of tomato is a homolog of the root-knot nematode resistance gene Mi Mol. Plant Microbe Interact. 13 1130 1138

    • Search Google Scholar
    • Export Citation
  • Canady, M.A., Ji, Y.F. & Chetelat, R.T. 2006 Homeologous recombination in Solanum lycopersicoides introgression lines of cultivated tomato Genetics 174 1775 1788

    • Search Google Scholar
    • Export Citation
  • Canady, M.A., Meglic, V. & Chetelat, R.T. 2005 A library of Solanum lycopersicoides introgression lines in cultivated tomato Genome 48 685 697

  • Canady, M.A., Stevens, M.R., Barineau, M.S. & Scott, J.W. 2001 Tomato spotted wilt virus (TSWV) resistance in tomato derived from Lycopersicon chilense Dun. LA 1938 Euphytica 117 19 25

    • Search Google Scholar
    • Export Citation
  • Chunwongse, J., Chunwongse, C., Black, L. & Hanson, P. 2002 Molecular mapping of the Ph-3 gene for late blight resistance in tomato J. Hort. Sci. Biotechnol. 77 281 286

    • Search Google Scholar
    • Export Citation
  • Chunwongse, J., Chunwongse, C., Black, L.L. & Hanson, P.M. 1998 Mapping of the Ph-3 gene for late blight from L. pimpinellifolium L3708 Rep. Tomato Genet. Coop. 48 963 971

    • Search Google Scholar
    • Export Citation
  • Dockter, K.G., O'Neil, D.S., Price, D.L., Scott, J. & Stevens, M.R. 2009 Molecular mapping of the Tomato spotted wilt virus resistance gene Sw-7 in tomato HortScience 44 1123

    • Search Google Scholar
    • Export Citation
  • Folkertsma, R.T., Spassova, M.I., Prins, M., Stevens, M.R., Hille, J. & Goldbach, R.W. 1999 Construction of a bacterial artificial chromosome (BAC) library of Lycopersicon esculentum cv. Stevens and its application to physically map the Sw-5 locus Mol. Breed. 5 197 207

    • Search Google Scholar
    • Export Citation
  • Foolad, M.R., Merk, H.L. & Ashrafi, H. 2008 Genetics, genomics and breeding of late blight and early blight resistance in tomato Crit. Rev. Plant Sci. 27 75 107

    • Search Google Scholar
    • Export Citation
  • Foster, S.J., Park, T.H., Pel, M., Brigneti, G., Sliwka, J., Jagger, L., van der Vossen, E. & Jones, J.D.G. 2009 Rpi-vnt1.1, a Tm-22 homolog from Solanum venturii, confers resistance to potato late blight Mol. Plant Microbe Interact. 22 589 600

    • Search Google Scholar
    • Export Citation
  • Fry, W.E. & Goodwin, S.B. 1997 Re-emergence of potato and tomato late blight in the United States Plant Dis. 81 1349 1357

  • Ganal, M.W. & Tanksley, S.D. 1996 Recombination around the Tm2a and Mi resistance genes in different crosses of Lycopersicon peruvianum Theor. Appl. Genet. 92 101 108

    • Search Google Scholar
    • Export Citation
  • Gardner, R.G. 2000 A male-sterile cherry tomato breeding line, NC2C ms-10, aa HortScience 35 964 965

  • Gardner, R.G. & Panthee, D.R. 2010 ‘Plum Regal’ fresh-market plum tomato hybrid and its parents, NC 25P and NC 30P HortScience 45 824 825

  • Gordillo, L.F., Stevens, M.R., Millard, M.A. & Geary, B. 2008 Screening two Lycopersicon peruvianum collections for resistance to Tomato spotted wilt virus Plant Dis. 92 694 704

    • Search Google Scholar
    • Export Citation
  • Kabelka, E., Franchino, B. & Francis, D.M. 2002 Two loci from Lycopersicon hirsutum LA407 confer resistance to strains of Clavibacter michiganensis subsp. michiganensis Phytopathology 92 504 510

    • Search Google Scholar
    • Export Citation
  • Kim, M.J. & Mutschler, M.A. 2005 Transfer to processing tomato and characterization of late blight resistance derived from Solanum pimpinellifolium L. L3708 J. Amer. Soc. Hort. Sci. 130 877 884

    • Search Google Scholar
    • Export Citation
  • Kim, M.J. & Mutschler, M.A. 2006 Characterization of late blight resistance derived from Solanum pimpinellifolium L3708 against multiple isolates of the pathogen Phytophthora infestans J. Amer. Soc. Hort. Sci. 131 637 645

    • Search Google Scholar
    • Export Citation
  • Lanfermeijer, F.C., Dijkhuis, J., Sturre, M.J.G., de Haan, P. & Hille, J. 2003 Cloning and characterization of the durable Tomato mosaic virus resistance gene Tm-22 from Lycopersicon esculentum Plant Mol. Biol. 52 1037 1049

    • Search Google Scholar
    • Export Citation
  • Liharska, T., Koornneef, M., vanWordragen, M., vanKammen, A. & Zabel, P. 1996 Tomato chromosome 6: Effect of alien chromosomal segments on recombinant frequencies Genome 39 485 491

    • Search Google Scholar
    • Export Citation
  • Mumford, R.A., Barker, I. & Wood, K.R. 1996 The biology of the Tospoviruses Ann. Appl. Biol. 128 159 183

  • Pel, M.A., Foster, S.J., Park, T.H., Rietman, H., van Arkel, G., Jones, J.D.G., van Eck, H.J., Jacobsen, E., Visser, R.G.F. & van der Vossen, E.A.G. 2009 Mapping and cloning of late blight resistance genes from Solanum venturii using an interspecific candidate gene approach Mol. Plant Microbe Interact. 22 601 615

    • Search Google Scholar
    • Export Citation
  • Pillen, K., Pineda, O., Lewis, C.B. & Tanksley, S.D. 1996 Status of genome mapping tools in the taxon Solonaceae 281 308 Paterson A.H. Genome mapping in plants Academic Press Austin, TX

    • Search Google Scholar
    • Export Citation
  • Price, D.L., Memmott, J.W., Scott, J.W., Olson, S. & Stevens, M.R. 2007 Identification of molecular markers linked to a new Tomato spotted wilt virus resistance source in tomato Rep. Tomato Genet. Coop. 57 35

    • Search Google Scholar
    • Export Citation
  • Roselló, S., Díez, M.J. & Nuez, F. 1996 Viral diseases causing the greatest economic losses to the tomato crop. I. The Tomato spotted wilt virus—A review Sci. Hort. 67 117 150

    • Search Google Scholar
    • Export Citation
  • Scott, J.W., Stevens, M.R. & Olson, S.M. 2005 An alternative source of resistance to Tomato spotted wilt virus Rep. Tomato Genet. Coop. 55 40 41

  • Stevens, J.M. 1964 Tomato breeding Dept. Agricultural Technical Services, Republic of South Africa, Project Report W-Vv1

  • Stevens, M.R., Heiny, D.K., Griffiths, P.D., Scott, J.W. & Rhoads, D.D. 1996 Identification of co-dominant RAPD markers tightly linked to the Tomato spotted wilt virus (TSWV) resistance gene Sw-5 Rep. Tomato Genet. Coop. 46 27 28

    • Search Google Scholar
    • Export Citation
  • Stevens, M.R., Lamb, E.M. & Rhoads, D.D. 1995 Mapping the Sw-5 locus for Tomato spotted wilt virus resistance in tomatoes using RAPD and RFLP analyses Theor. Appl. Genet. 90 451 456

    • Search Google Scholar
    • Export Citation
  • Stevens, M.R., Scott, S.J. & Gergerich, R.C. 1992 Inheritance of a gene for resistance to Tomato spotted wilt virus (TSWV) from Lycopersicon peruvianum Mill Euphytica 59 9 17

    • Search Google Scholar
    • Export Citation
  • Tanksley, S.D., Ganal, M.W., Prince, J.P., de Vicente, M.C., Bonierbale, M.W., Broun, P., Fulton, T.M., Giovannoni, J.J., Grandillo, S., Martin, G.B., Messeguer, R., Miller, J.C., Miller, L., Paterson, A.H., Pineda, O., Roder, M.S., Wing, R.A., Wu, W. & Young, N.D. 1992 High density molecular linkage maps of the tomato and potato genomes Genetics 132 1141 1160

    • Search Google Scholar
    • Export Citation
  • Van Ooijen, J.W. & Voorrips, R.E. 2001 JoinMap® 3.0, software for the calculation of genetic linkage maps Plant Research International Wageningen, The Netherlands

    • Search Google Scholar
    • Export Citation
  • van Zijl, J.J.B., Bosch, S.E. & Coetzee, C.P.J. 1986 Breeding tomatoes for processing in South Africa Acta Hort. 194 69 75

  • Yang, W.C. & Francis, D.M. 2005 Marker-assisted selection for combining resistance to bacterial spot and bacterial speck in tomato J. Amer. Soc. Hort. Sci. 130 716 721

    • Search Google Scholar
    • Export Citation
  • Zamir, D. & Tadmor, Y. 1986 Unequal segregation of nuclear genes in plants Bot. Gaz. 147 355 358

Contributor Notes

To whom reprint requests should be addressed; e-mail mikel_stevens@byu.edu.

  • Anfoka, G.H., Abhary, M. & Stevens, M.R. 2006 Occurrence of Tomato spotted wilt virus (TSWV) in Jordan EPPO Bulletin 36 517 522

  • AVRDC 1998 AVRDC Report 1997 Asian Vegetable Research and Development Center Shanhua, Tainan, Taiwan

  • Bioteux, L.S., Nagata, T. & Giordano, L.B. 1993 Field resistance of tomato Lycopersicon esculentum lines to tomato spotted wilt disease Rep. Tomato Genet. Coop. 43 7 9

    • Search Google Scholar
    • Export Citation
  • Black, L.L., Wang, T.C., Hanson, P.M. & Chen, J.T. 1996a Late blight resistance in four wild tomato accessions, effectiveness in diverse locations and inheritance of resistance Phytopathology 86 S24

    • Search Google Scholar
    • Export Citation
  • Black, L.L., Wang, T.C. & Huang, Y.H. AVRDC 1996b New sources of late blight resistance identified in wild tomatoes Tropical Vegetable Information Service Newsletter 1 15 17

    • Search Google Scholar
    • Export Citation
  • Brommonschenkel, S.H., Frary, A. & Tanksley, S.D. 2000 The broad-spectrum tospovirus resistance gene Sw-5 of tomato is a homolog of the root-knot nematode resistance gene Mi Mol. Plant Microbe Interact. 13 1130 1138

    • Search Google Scholar
    • Export Citation
  • Canady, M.A., Ji, Y.F. & Chetelat, R.T. 2006 Homeologous recombination in Solanum lycopersicoides introgression lines of cultivated tomato Genetics 174 1775 1788

    • Search Google Scholar
    • Export Citation
  • Canady, M.A., Meglic, V. & Chetelat, R.T. 2005 A library of Solanum lycopersicoides introgression lines in cultivated tomato Genome 48 685 697

  • Canady, M.A., Stevens, M.R., Barineau, M.S. & Scott, J.W. 2001 Tomato spotted wilt virus (TSWV) resistance in tomato derived from Lycopersicon chilense Dun. LA 1938 Euphytica 117 19 25

    • Search Google Scholar
    • Export Citation
  • Chunwongse, J., Chunwongse, C., Black, L. & Hanson, P. 2002 Molecular mapping of the Ph-3 gene for late blight resistance in tomato J. Hort. Sci. Biotechnol. 77 281 286

    • Search Google Scholar
    • Export Citation
  • Chunwongse, J., Chunwongse, C., Black, L.L. & Hanson, P.M. 1998 Mapping of the Ph-3 gene for late blight from L. pimpinellifolium L3708 Rep. Tomato Genet. Coop. 48 963 971

    • Search Google Scholar
    • Export Citation
  • Dockter, K.G., O'Neil, D.S., Price, D.L., Scott, J. & Stevens, M.R. 2009 Molecular mapping of the Tomato spotted wilt virus resistance gene Sw-7 in tomato HortScience 44 1123

    • Search Google Scholar
    • Export Citation
  • Folkertsma, R.T., Spassova, M.I., Prins, M., Stevens, M.R., Hille, J. & Goldbach, R.W. 1999 Construction of a bacterial artificial chromosome (BAC) library of Lycopersicon esculentum cv. Stevens and its application to physically map the Sw-5 locus Mol. Breed. 5 197 207

    • Search Google Scholar
    • Export Citation
  • Foolad, M.R., Merk, H.L. & Ashrafi, H. 2008 Genetics, genomics and breeding of late blight and early blight resistance in tomato Crit. Rev. Plant Sci. 27 75 107

    • Search Google Scholar
    • Export Citation
  • Foster, S.J., Park, T.H., Pel, M., Brigneti, G., Sliwka, J., Jagger, L., van der Vossen, E. & Jones, J.D.G. 2009 Rpi-vnt1.1, a Tm-22 homolog from Solanum venturii, confers resistance to potato late blight Mol. Plant Microbe Interact. 22 589 600

    • Search Google Scholar
    • Export Citation
  • Fry, W.E. & Goodwin, S.B. 1997 Re-emergence of potato and tomato late blight in the United States Plant Dis. 81 1349 1357

  • Ganal, M.W. & Tanksley, S.D. 1996 Recombination around the Tm2a and Mi resistance genes in different crosses of Lycopersicon peruvianum Theor. Appl. Genet. 92 101 108

    • Search Google Scholar
    • Export Citation
  • Gardner, R.G. 2000 A male-sterile cherry tomato breeding line, NC2C ms-10, aa HortScience 35 964 965

  • Gardner, R.G. & Panthee, D.R. 2010 ‘Plum Regal’ fresh-market plum tomato hybrid and its parents, NC 25P and NC 30P HortScience 45 824 825

  • Gordillo, L.F., Stevens, M.R., Millard, M.A. & Geary, B. 2008 Screening two Lycopersicon peruvianum collections for resistance to Tomato spotted wilt virus Plant Dis. 92 694 704

    • Search Google Scholar
    • Export Citation
  • Kabelka, E., Franchino, B. & Francis, D.M. 2002 Two loci from Lycopersicon hirsutum LA407 confer resistance to strains of Clavibacter michiganensis subsp. michiganensis Phytopathology 92 504 510

    • Search Google Scholar
    • Export Citation
  • Kim, M.J. & Mutschler, M.A. 2005 Transfer to processing tomato and characterization of late blight resistance derived from Solanum pimpinellifolium L. L3708 J. Amer. Soc. Hort. Sci. 130 877 884

    • Search Google Scholar
    • Export Citation
  • Kim, M.J. & Mutschler, M.A. 2006 Characterization of late blight resistance derived from Solanum pimpinellifolium L3708 against multiple isolates of the pathogen Phytophthora infestans J. Amer. Soc. Hort. Sci. 131 637 645

    • Search Google Scholar
    • Export Citation
  • Lanfermeijer, F.C., Dijkhuis, J., Sturre, M.J.G., de Haan, P. & Hille, J. 2003 Cloning and characterization of the durable Tomato mosaic virus resistance gene Tm-22 from Lycopersicon esculentum Plant Mol. Biol. 52 1037 1049

    • Search Google Scholar
    • Export Citation
  • Liharska, T., Koornneef, M., vanWordragen, M., vanKammen, A. & Zabel, P. 1996 Tomato chromosome 6: Effect of alien chromosomal segments on recombinant frequencies Genome 39 485 491

    • Search Google Scholar
    • Export Citation
  • Mumford, R.A., Barker, I. & Wood, K.R. 1996 The biology of the Tospoviruses Ann. Appl. Biol. 128 159 183

  • Pel, M.A., Foster, S.J., Park, T.H., Rietman, H., van Arkel, G., Jones, J.D.G., van Eck, H.J., Jacobsen, E., Visser, R.G.F. & van der Vossen, E.A.G. 2009 Mapping and cloning of late blight resistance genes from Solanum venturii using an interspecific candidate gene approach Mol. Plant Microbe Interact. 22 601 615

    • Search Google Scholar
    • Export Citation
  • Pillen, K., Pineda, O., Lewis, C.B. & Tanksley, S.D. 1996 Status of genome mapping tools in the taxon Solonaceae 281 308 Paterson A.H. Genome mapping in plants Academic Press Austin, TX

    • Search Google Scholar
    • Export Citation
  • Price, D.L., Memmott, J.W., Scott, J.W., Olson, S. & Stevens, M.R. 2007 Identification of molecular markers linked to a new Tomato spotted wilt virus resistance source in tomato Rep. Tomato Genet. Coop. 57 35

    • Search Google Scholar
    • Export Citation
  • Roselló, S., Díez, M.J. & Nuez, F. 1996 Viral diseases causing the greatest economic losses to the tomato crop. I. The Tomato spotted wilt virus—A review Sci. Hort. 67 117 150

    • Search Google Scholar
    • Export Citation
  • Scott, J.W., Stevens, M.R. & Olson, S.M. 2005 An alternative source of resistance to Tomato spotted wilt virus Rep. Tomato Genet. Coop. 55 40 41

  • Stevens, J.M. 1964 Tomato breeding Dept. Agricultural Technical Services, Republic of South Africa, Project Report W-Vv1

  • Stevens, M.R., Heiny, D.K., Griffiths, P.D., Scott, J.W. & Rhoads, D.D. 1996 Identification of co-dominant RAPD markers tightly linked to the Tomato spotted wilt virus (TSWV) resistance gene Sw-5 Rep. Tomato Genet. Coop. 46 27 28

    • Search Google Scholar
    • Export Citation
  • Stevens, M.R., Lamb, E.M. & Rhoads, D.D. 1995 Mapping the Sw-5 locus for Tomato spotted wilt virus resistance in tomatoes using RAPD and RFLP analyses Theor. Appl. Genet. 90 451 456

    • Search Google Scholar
    • Export Citation
  • Stevens, M.R., Scott, S.J. & Gergerich, R.C. 1992 Inheritance of a gene for resistance to Tomato spotted wilt virus (TSWV) from Lycopersicon peruvianum Mill Euphytica 59 9 17

    • Search Google Scholar
    • Export Citation
  • Tanksley, S.D., Ganal, M.W., Prince, J.P., de Vicente, M.C., Bonierbale, M.W., Broun, P., Fulton, T.M., Giovannoni, J.J., Grandillo, S., Martin, G.B., Messeguer, R., Miller, J.C., Miller, L., Paterson, A.H., Pineda, O., Roder, M.S., Wing, R.A., Wu, W. & Young, N.D. 1992 High density molecular linkage maps of the tomato and potato genomes Genetics 132 1141 1160

    • Search Google Scholar
    • Export Citation
  • Van Ooijen, J.W. & Voorrips, R.E. 2001 JoinMap® 3.0, software for the calculation of genetic linkage maps Plant Research International Wageningen, The Netherlands

    • Search Google Scholar
    • Export Citation
  • van Zijl, J.J.B., Bosch, S.E. & Coetzee, C.P.J. 1986 Breeding tomatoes for processing in South Africa Acta Hort. 194 69 75

  • Yang, W.C. & Francis, D.M. 2005 Marker-assisted selection for combining resistance to bacterial spot and bacterial speck in tomato J. Amer. Soc. Hort. Sci. 130 716 721

    • Search Google Scholar
    • Export Citation
  • Zamir, D. & Tadmor, Y. 1986 Unequal segregation of nuclear genes in plants Bot. Gaz. 147 355 358

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 846 233 18
PDF Downloads 468 191 20