Abstract
Cultivated tomato (Solanum lycopersicum L.) accessions have been susceptible to the whitefly-transmitted begomoviruses Tomato yellow leaf curl virus (TYLCV) and Tomato mottle virus (ToMoV) that can cause serious crop damage. S. habrochaites accession LA1777 has been reported to be resistant to TYLCV. To locate putative virus resistance genes, 89 recombinant inbred lines (RILs) previously developed from LA1777 in a tomato background, LA1777 and the susceptible RIL parent E6203, were screened against the begomoviruses TYLCV and ToMoV. An initial study showed 18 RILs had less disease severity to TYLCV or ToMoV. Eight RILs had S. habrochaites alleles at TG27 (restriction fragment length polymorphism marker) on chromosome 1, three RILs had S. habrochaites alleles at TG202 on chromosome 7, and one RIL had S. habrochaites alleles at both marker loci. The RILs with these regions were intercrossed in 10 different cross combinations and F2 seeds were then obtained. The F2 progenies were inoculated separately with both viruses and then evaluated in the field. The F2 plants with less disease severity were selected, but most did not have the markers from the hypothetical resistance regions. The F3 progenies were then inoculated and rated for disease severity to both viruses. None of the F3s demonstrated any increased level of resistance, even if derived from F2s homozygous for the target regions from both chromosomes. All plants from every cross combination were susceptible for both TYLCV and ToMoV, suggesting that there is no begomovirus resistance in the LA1777 RIL population. Some limitations of capturing all genes in an RIL population derived from an outcrossing accession are discussed.
The begomoviruses, Tomato yellow leaf curl virus (TYLCV) and Tomato mottle virus (ToMoV), vectored by the silverleaf whitefly (Bemisia argentifolii Bellows & Perring) can cause severe losses in tomato production. Most cultivated tomatoes are extremely susceptible to these diseases, and yield losses can reach 100% if plants are infected in early growth stages, especially by TYLCV (Green and Kallo, 1994; Picó et al., 1996). Accessions of several wild Solanum species, including S. habrochaites S. Knapp & D.M. Spooner., S. chilense (Dunal) Reiche., S. pimpinellifolium (Jusl.) Mill., S. cheesmanii (L. Riley), and S. peruvianum (L.) Mill., have been reported by many authors to have TYLCV resistance, and intensive breeding efforts have been undertaken to develop cultivars with TYLCV resistance (Scott, 2006). Several accessions of S. habrochaites have been reported to be resistant to TYLCV (Ji et al., 2007), and some of these accessions have been used in breeding programs for developing TYLCV-resistant lines. The accession of S. habrochaites B6013 has demonstrated excellent resistance to TYLCV from Taiwan to south India (Kallo and Banerjee, 1990), and resistance in this accession was reported to be controlled by two epistatic genes (Banerjee and Kallo, 1987). One resistant line, H24, has been developed from this accession and a gene controlling TYLCV (Ty-2) in it has been mapped to chromosome 11 (Hanson et al., 2000, 2006). The accession LA1777 was reported to be highly resistant to TYLCV (Fargette, 1991; Hanson, 1999; Ioannou, 1985; Moustafa, 1991) and also to ToMoV (Hanson, 1999). Another accession of S. habrochaites, LA0386, has also been reported as resistant to TYLCV with dominant control by more than one gene (Hassan et al., 1984). Picó et al. (2000) reported that LA0386 had a higher level of resistance than LA1777 when using agroinoculation. Vidavsky and Czosnek (1998) developed a TYLCV-resistant line named Ih902 from a cross between S. habrochaites accessions LA1777 and LA0386 followed by crossing to S. lycopersicum and selfing resistant, symptomless individuals. The authors suggested that the resistance in this line is controlled by one major dominant gene with some minor genes. The line Ih902 has been evaluated and used as a broad-based source of resistance for begomovirus resistance breeding programs in Guatemala, where seven bipartite begomoviruses have been reported (MejÃa et al., 2005; Nakhla et al., 2005), and for TYLCV resistance breeding programs in Middle Eastern countries (Maruthi et al., 2003). However, there is no report specifically describing the origin and chromosomal location of resistance gene(s) in line Ih902.
Recombinant inbred lines (RILs) derived from LA1777 in S. lycopersicum (Monforte and Tanksley, 2000), that cover ≈83% of the S. habrochaites genome, are available and provide a means to locate genes with resistance to TYLCV and other begomoviruses. Therefore, we screened 89 of these RILs for resistance to TYLCV and ToMoV. In an initial study, none of the RILs demonstrated a high level of resistance to either disease (Momotaz et al., 2005). However, 18 lines displayed potentially low levels of resistance to ToMoV or TYLCV. Nine of these lines had S. habrochaites alleles at TG27 [restriction fragment length polymorphism marker (RFLP)] on chromosome 1 and four of the lines had S. habrochaites alleles at TG202 on chromosome 7 (Momotaz et al., 2005). We hypothesized that minor genes in these regions on chromosomes 1 and 7 might provide better resistance when combined. Thus, the objective of this work was to combine RILs expressing low levels of resistance to determine if higher levels of resistance could be obtained and, thus, identify the location of genes from LA1777 resistant to TYLCV and ToMoV.
Materials and Methods
Spring and Fall 2004
In the Spring of 2004, crosses were made between RILs with markers that were correlated with the low levels of resistance from 2003 testing (Table 1). The developed hybrids were designated 401 to 410. Seeds were bulked from 10 plants of each F1 hybrid grown in the field to obtain F2 seeds in the Fall of 2004.
Crosses of recombinant inbred lines (RILs) that had partial begomovirus resistance from previous testing and restriction fragment length polymorphism markers (RFLPs) associated with the RILs.
Spring 2005
In the Spring of 2005, seeds of the 10 F2 lines, the susceptible control ‘Horizon’, and the resistant control line 927 (advanced breeding line derived from S. chilense accession LA1932) were sown in flats containing Black Beauty spent coal (Reed Minerals Div., Highland, IN) on 25 Jan. Seedlings of these lines were transplanted at the cotyledon stage into two sets of Speedling trays (3.8-cm2 cell size; Speedling, Sun City, FL) in the greenhouse on 7 Feb. On 25 Feb., trays were moved into whitefly-proof greenhouses for virus inoculation.
Inoculation.
Inoculation was done according to the method described by Griffiths and Scott (2001). Two B. argentifolii colonies viruliferous for TYLCV or ToMoV were maintained separately on plants of the dwarf tomato ‘Florida Lanai’. Plants at the three leaf stage were inoculated separately for 16 d by placing them in growth chambers with TYLCV- or ToMoV-infested ‘Florida Lanai’ plants. There were two virus-infected source plants per ≈550 test plants. Each inoculation plant had eight to 12 leaves and each was heavily infested with whitefly adults and immature life stages. The source plants were shaken daily to disperse whitefly adults onto the test plants. On 14 Mar., whiteflies were killed with a foliar application of a 1% v/v solution of M-Pede® (potassium salts of fatty acids; Dow AgroSciences LLC, Indianapolis, IN). The trays were then drenched with Admire 2F® (imidacloprid; Bayer CropScience LP, Research Triangle Park, NC) at the rate of ≈3 mL/1000 plants. On 21 and 22 Mar., the inoculated seedlings of TYLCV and ToMoV, respectively, were transplanted into separate field plots for each disease.
Twenty plants per F2 were planted and spaced 46 cm apart within rows with 152 cm between rows. The beds had been fumigated with 67% methyl bromide:33% chloropicrin at 197 kg·ha−1 and covered with white plastic mulch. The plants were fertilized with a total of 293 kg·ha−1 of nitrogen and 486 kg·ha−1 of potassium placed in two bands 15 cm from the plants on top of the beds using granular fertilizer. The plants were staked and tied and irrigated by seepage ditches adjacent to three experimental beds. Plants were sprayed with pesticides as needed throughout the season.
Resistance assessment was began 45, 60, and 70 d after inoculation (DAI) in the field. Disease severity was rated using a 0 to 4 scale of Scott et al. (1996) in which 0 = no symptoms, 1 = slight symptoms visible only on close inspection, 2 = mild symptoms on part of the plant, 3 = severe symptoms over the entire plant, and 4 = severe symptoms and stunting. The plants were also subjectively rated for general vigor. A plant was considered tolerant if it had a lower virus disease severity rating with greater vigor. Data from the rating 70 DAI were used for analysis.
Fall 2005
Twenty F2 plants with less disease were selected during the Spring of 2005 and their F3 progenies were inoculated and evaluated in the Fall of 2005. Seeds of the 20 F3, susceptible control ‘Horizon’, and resistant control 927 were sown in Black Beauty spent coal on 27 July. Seedlings were transplanted on 8 Aug. (17 d) into two sets of Speedling trays, and inoculation began on 26 Aug. On 12 Sept., whiteflies were killed and on 3 and 4 Oct., the seedlings inoculated with TYLCV and ToMoV, respectively, were then transplanted in separate field plots. Each of the genotypes had 10 plants. Fertilization, irrigation, and all other cultural practices were the same as in Spring of 2005.
DNA extraction and polymerase chain reaction amplification.
Genomic DNA was isolated from fully expanded leaf tissues of the F2 plants (selected for lower disease severity and more vigor) using a simple DNA isolation procedure (Fulton et al., 1995). Cleaved amplified polymorphic sequence (CAPS) markers of RFLP clones TG27 (forward sequence 5′-TTGGGCGTTTAAAAA GTTGG; reverse sequence 5′- GCGGTTTTCAACAACCAAAA) and TG202 (forward sequence 5′-AGGATGCAATGGTGAGGAAG-3′; reverse sequence 5′-CACTGCATTGTGTCGAAC CT-3′) were designed from the DNA sequences available at Sol Genomics Network (http://sgn.cornell.com) and the other CAPS TG180 markers used in this experiment were selected from Sol Genomics Network. The polymerase chain reaction (PCR) amplification reactions for each of the markers were performed according to the procedures of Momotaz et al. (2004) in a 10-μL reaction volume. PCR amplification was carried out with a DNA automated thermocycler (Gene Amp; Applied Biosystems, CA). Approximately 4 μL of the amplified DNA fragments obtained with oligonucleotides designed from the probes TG27 and TG202 were digested in a total volume of 10 μL for 2 h with 1.5 units of the Tsp5091 and DpnII restriction endonuclease to yield codominant markers. Restriction fragments were separated on 2% (w/v) agarose gels (Genetic analysis grade; Fisher Scientific, Fair Lawn, NJ) containing ethidium bromide (1.0 μg/mL−1) in 1 × TBE buffer visualized under ultraviolet transillumination and photographed using the AlphaImager Imaging System (San Leandro, CA).
Results
The resistant control 927 was highly resistant to both TYLCV and ToMoV (Table 2). A very high percentage of the F2 plants were severely infected with both diseases and only 4% of TYLCV-inoculated and 2% of ToMoV-inoculated plants had early ratings less than 3 (Table 2). The lack of plants with intermediate ratings is a pattern favoring a few escapes as opposed to the few plants having resistance. Accordingly, most of the plants with earlier lower ratings eventually became more heavily infected and were considered susceptible in later ratings. Nevertheless, 23 plants that had lower ratings in the early season were selected and analyzed for their potential markers (Table 3). Very few were homozygous for marker(s) from the hypothetical resistance regions. Thus, it does not appear that these regions are linked to resistance genes. Seeds were sown from 20 of the 23 F2 plants and F3 progenies were evaluated for both diseases in the following season (Table 4). The F3s had very high percentages (97% TYLCV inoculated and 92% ToMoV inoculated) of severely infected plants and some had a few plants less severely infected. There was no increase in resistant progeny as would be expected if parents had resistance. The genotype 927 was highly resistant like in the previous season. ‘Horizon’ had some escapes, especially for ToMoV, and actually had more plants with intermediate disease severity for TYLCV than did the F3s for reasons unknown to us.
TYLCV and ToMoV disease severity frequency distributions and means at 70 d after inoculation began for F2 genotypes in the Spring of 2005.
Marker analysis of some selected F2 plants with their individual disease severity ratings for TYLCV and ToMoV.
TYLCV and ToMoV disease severity frequency distributions and means 70 d after inoculation began for 20 F3 genotypes in the Fall of 2005.
Discussion
We found no evidence for resistance to TYLCV or ToMoV in lines derived from RILs that were combined based on their more vigorous growth after inoculation in an earlier study (Momotaz et al., 2005). Further evidence that regions on chromosomes 1 and 7 were not associated with TYLCV or ToMoV resistance was found when CAPS markers linked to S. habrochaites introgressions were absent in line Ih902 (data not shown). Line Ih902 was derived from S. habrochaites (Vidavsky and Czosnek, 1998) and has been highly resistant to begomoviruses in Guatemala, where it has been used in a begomovirus resistance breeding program (MejÃa et al., 2005). The present study along with our previous one (Momotaz et al., 2005) strongly indicate that resistance genes for TYLCV or ToMoV are not present in the 83% of the S. habrochaites genome covered by the RIL population used in our experiments. Resistance gene(s) derived by Vidavsky and Czosnek (1998) may be introgressed from LA386 or from part of the LA1777 genome not present in the RILs. This could include the ≈17% not present in RILs or other genes not represented by the RILs. The latter is possible because S. habrochaites accession LA1777 is an outcrossing species, in which resistance alleles may not be fixed. The RILs were derived from a single plant (Bernacchi and Tanksley, 1997) that likely did not have all of the genetic variation of LA1777. Further evidence for this possibility emerged from our LA1777 whitefly resistance work. We detected regions that may be associated with silverleaf whitefly resistance based on CAPS markers and an interspecific F2 population. However, three of the RILs that should have had a CAPS marker did not have the polymorphism (data not shown). At present, the source(s) of resistance reported by Vidavsky and Czosnek (1998) remain unknown. Picó et al. (2000) provided evidence that LA0386 had better TYLCV resistance than LA1777 and it may be that the resistance was derived from LA0386. In this work, agroinoculation was used, which would circumvent infection by the whitefly. This is important because LA1777 has a high density of type IV glandular trichomes and is not attractive to the whitefly (see Muigai et al., 2003). Some previous studies reporting resistance to TYLCV from LA1777 have not addressed this issue. However, resistance from LA1777 cannot be ruled out unequivocally, although we have shown that the resistance is not present in the LA1777 RILs. Other researchers should be aware of this before they attempt to locate resistance in the LA1777 RIL population.
Literature Cited
Banerjee, M.K. & Kallo, G. 1987 Inheritance of tomato leaf curl virus resistance in Lycopersicon hirsutum f. glabratum Euphytica 36 581 584
Bernacchi, D. & Tanksley, S.D. 1997 An interspecific backcross of Lycopersicon esculentum × L. hirsutum: Linkage analysis and a QTL study of sexual compatibility factors and floral traits Genetics 147 861 877
Fargette, D. 1991 Quelques proprietes de la resistance varietale a l'enroulement de la tomate 47 49 Latrrot H. & Trousse C. Resistance of the Tomato to TYLCV. Proceedings of the seminar of EEC contract DGXII-TS2-A-055 F (CD) partners INRA-Stationd'Amelioration des Plantes Maraicheres Montfavet-Avignon, France
Fulton, T.M. , Chunwongse, J. & Tanksley, S.D. 1995 Microprep protocol for extraction of DNA from tomato and other herbaceous plants Plant Mol. Biol. Rep. 13 207 209
Green, S.K. & Kallo, G. 1994 Leaf curl and yellowing viruses of pepper and tomato: An overview Asian Veg. Res. Dev. Ctr Shanhua, Taiwan Tech. Bul. 21.
Griffiths, P.D. & Scott, J.W. 2001 Inheritance and linkage of tomato mottle virus resistance genes derived from Lycopersicon chilense accession LA1932 J. Amer. Hort. Sci. 126 462 467
Hanson, P. 1999 Off-season tomato, pepper and eggplant Report. AVRDC 30 May 2007 <www.avrdc.org/pdf/99annual_report/proj01.pdf>. 5 23
Hanson, P.M. , Bernacchi, D. , Green, S. , Tanksley, S.D. , Venkataramappa, M. , Padmaja, A.S. , Chen, H. , Kuo, G. , Fang, D. & Chen, J. 2000 Mapping a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line J. Amer. Soc. Hort. Sci. 125 15 20
Hanson, P.M. , Green, S.K. & Kuo, G. 2006 Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Rept Tomato Genetics Coop. 56 17 18
Hassan, A.A. , Mazayd, H.M. , Moustafa, S.E. , Nassar, S.H. , Nakhla, M.K. & Sims, W.L. 1984 Inheritance of resistance to tomato yellow leaf curl virus derived from Lycopersicon cheesmanii and Lycopersicon hirsutum Hort. Sci. 19 574 575
Ioannou, N. 1985 Yellow leaf curl and other diseases of tomato in Cyprus Plant Pathol. 345 428 434
Ji, Y. , Scott, J.W. , Hanson, P. , Graham, E. & Maxwell, D.P. 2007 Sources of resistance, inheritance, and location of genetic loci conferring resistance to members of the tomato-infecting begomoviruses 347 366 Czosnek H. Tomato Yellow Leaf Curl Virus disease: Management, molecular biology, breeding for resistance Kluwer Academic Publishers Dordrecht, The Netherlands
Kallo, G. & Banerjee, M.K. 1990 Transfer of tomato leaf curl virus resistance from Lycopersicon hirsutum f. glabratum to L. esculentum Plant Breed. 105 156 159
Maruthi, M.N. , Czosnek, H. , Vidavski, F. , Tarba, H.-Y. , Milo, J. , Leviatov, S. , Venkatesh, H.M. , Padmaja, A.S. , Kulkarni, R.S. & Muniyappa, V. 2003 Comparison of resistance to Tomato leaf curl virus (India) and Tomato yellow leaf curl virus (Israel) among Lycopersicon wild species, breeding lines and hybrids Eur. J. Plant Pathol. 109 1 11
MejÃa, L. , Teni, R.E. , Vidavski, F. , Czosnek, H. , Lapidot, M. , Nakhla, M.K. & Maxwell, D.P. 2005 Evaluation of tomato germplasm and selection of breeding lines for resistance to begomoviruses in Guatemala Acta Hort. 695 251 255
Momotaz, A. , Forster, J.W. & Yamada, T. 2004 Identification of cultivars and accessions of Lolium, Festuca and Festulolium hybrids through the detection of simple sequence repeat polymorphism Plant Breed. 123 370 376
Momotaz, A. , Scott, J.W. & Schuster, D.J. 2005 Searching for silverleaf whitefly and begomovirus resistance genes from Lycopersicon hirsutum accession LA1777 Acta Hort. 695 417 422 (ISHS).
Monforte, A.J. & Tanksley, S.D. 2000 Development of a set of near isogenic and backcross recombinant inbred lines containing most of the Lycopersicon hirsutum genome in a L. esculentum genetic background: A tool for gene mapping and gene discovery Genome 43 803 813
Moustafa, S.E. 1991 Tomato cultivation and breeding program for tomato yellow leaf curl virus 6 8 Laterrot H. & Trousse C. Resistance of the Tomato to TYLCV, Proceedings of the seminar of EEC contract DGXII-TS2-A-055 F (CD) partners INRA-Station de'Amelioration des Plantes Maraicheres Montfavet-Avignon, France
Muigai, S.G. , Bassett, M.J. , Schuster, D.J. & Scott, J.W. 2003 Greenhouse and field screening of wild Lycopersicon germplasm for resistance to the whitefly Bemisia argentifolii Phytoparasitica 31 27 38
Nakhla, M.K. , Sorenson, A. , MejÃa, L. , RamÃrez, P. , Karkashian, J.P. & Maxwell, D.P. 2005 Molecular characterization of tomato-infecting begomoviruses in Central America and development of DNA-based detection methods Acta Hort. 695 277 288
Picó, B. , DÃez, M.J. & Nuez, F. 1996 Viral diseases causing the greatest economic losses to the tomato crop. II. The tomato yellow leaf curl virus—A review Scientia Hort. 67 151 196
Picó, B. , Sifres, A. , Elia, M. , DÃez, M.J. & Nuez, F. 2000 Searching for new resistance sources to tomato yellow leaf curl virus within a highly variable wild Lycopersicon genetic pool Physiol. Plant. 22 344 350
Scott, J.W. 2006 Breeding for resistance to viral pathogens 447 474 Razdan M.K. & Mattoo A.K. Genetic improvement of solanaceous crops. Vol. 2: Tomato Science Publishers Enfield, NH
Scott, J.W. , Stevens, M.R. , Barten, J.H.M. , Thome, C.R. , Polston, J.E. , Schuster, D.J. & Serra, C.-A. 1996 Introgression of resistance to whitefly-transmitted geminiviruses from Lycopersicon chilense to tomato 357 367 Gerling D. & Mayer R.T. Bemisia 1995; Taxonomy, Biology, Damage, Control and Management Intercept press Andover, Hants, UK
Vidavsky, F. & Czosnek, H. 1998 Tomato breeding lines resistant and tolerant to tomato yellow leaf curl virus (TYLCV) issued from Lycopersicon hirsutum Phytopathology 88 910 914