Advertisement

Development of Molecular Markers Linked to Cladosporium fulvum Resistant Gene Cf-6 in Tomato by RAPD and SSR Methods

Authors:
Aoxue WangDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Aoxue Wang in
Google Scholar
Close
,
Fanjuan MengDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Fanjuan Meng in
Google Scholar
Close
,
Xiangyang XuDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Xiangyang Xu in
Google Scholar
Close
,
Yong WangDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Yong Wang in
Google Scholar
Close
, and
Jingfu LiDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Jingfu Li in
Google Scholar
Close

Abstract

Leaf mold, caused by the fungus Cladosporium fulvum, is a serious disease of tomato. In the current study, the main physiological races of C. fulvum collected from three northeastern provinces of China were identified using a set of identification hosts. The results showed that the prevalent pathogenic physiological races were 1.2.3, 1.3, 3, 1.2.3.4, and 1.2.4. F1, F2, and BC1 tomato plants were obtained by crossing C. fulvum-resistant cultivar 03748 carrying the Cf-6 gene and susceptible cultivar 03036. Three 10-mer oligonucleotide random amplified polymorphic DNA (RAPD) primers and two simple sequence repeat (SSR) primers were selected for the further molecular marking analysis after 210 RAPD primers and 50 SSR primers were screened using the bulked segregate analysis method. The polymorphic DNA bands were amplified among parents, 10 F1 plants, 184 F2 plants including 145 resistant plants and 39 sensitive plants using three RAPD primers and two SSR primers so that three RAPD molecular markers and two SSR molecular markers linked to the Cf-6 loci were identified. Three RAPD markers were linked to the Cf-6 resistant locus separated with 8.7 cM, 20.3 cM, and 33.4 cM. Also, one RAPD codominant marker S374619/559 was found. The locations of the two SSR markers were 12.6 cM and 9.7 cM away from the Cf-6 locus. After cloning and sequencing two specific DNA fragments closely connected to the Cf-6 resistant and susceptible alleles respectively, in the RAPD codominant marker S374619/559 and one codominant sequence characterized amplified region marker S674619/559 was converted from RAPD marker S374619/559. In the RAPD marker S374619/559, the length difference of two specific fragments, 619-bp fragment and 559-bp fragment, is the result of one insertion (60 bp) in the 619-bp fragment. These markers will facilitate the selection of resistant tomato germplasm containing the Cf-6 gene and cloning of Cf-6 to breed new C. fulvum resistant tomato cultivars.

Tomato leaf mold, caused by the fungus Cladosporium fulvum, is a serious threat to tomato production, especially on greenhouse-grown tomatoes, because it lowers both fruit yield and quality, and sometimes kills tomato plants (Thomma et al., 2005). The disease is difficult to manage because new physiological races of the pathogen can develop very rapidly (Russell, 1978; Stevens and Rick, 1986; Zhang and Cai, 1992, 1999). Fortunately, at least 24 resistant genes also have been found in some tomato germplasm that are resistant to different physiological races of C. fulvum (Kanwar et al., 1980a, 1980b). Consequently, breeding to obtain resistant cultivars is an efficient method to control leaf mold outbreaks. Some of 24 resistant genes, designated Cf-1 through Cf-24, have been used in tomato C. fulvum resistant breeding to control leaf mold disease (Kerr and Bailey, 1964; Meng et al., 2005). However, according to the “gene-for-gene” principle (Flor, 1946), the use of new resistance genes accelerates the differentiation of physiological races, making it necessary to breed new resistant genes into new cultivars. This means that the status of physiological races must first be identified before a resistant germplasm breeding program can be implemented.

Also, to breed new resistant tomato cultivars, the germplasm carrying resistant genes must first be screened. Although conventional artificial inoculation can be applied in germplasm screening, it is labor intensive and time-consuming. The development of molecular markers provides the possibility of rapid screening of resistant germplasm for breeding. Moreover, molecular markers tightly linked to resistant genes also provide the basis for isolating and cloning the resistant gene. Until now, the Cf-2, Cf-4, Cf-4A, Cf-5A, and Cf-9 genes have been isolated (Dixon et al., 1996; Dixon et al., 1998; Jones et al., 1994; Takken et al., 1998; Thomas et al., 1997). Fortunately, the resistance provided by the Cf-9 gene has not been overcome by all C. fulvum physiological races that have been found (Du et al., 1999). Although we may use the Cf-9 gene for breeding a new tomato cultivar, physiological races of C. fulvum will redifferentiate after cultivars carrying the Cf-9 gene are used, and resistant cultivars carrying the Cf-9 gene will become susceptible to these new strains. Thus, if no germplasm carrying a new resistant gene to the new strains of C. fulvum is found, cultivars resistant to the new strains cannot be bred. Breeding for resistance is a long-term disease management strategy; the use of resistant genes depends upon the dynamics of physiological race differentiation in the field. The overuse of resistant genes leads to the breakdown of a cultivars’ resistance, and we will not have the available resistant germplasm. Moreover, more than one disease-resistant gene usually can give cumulative and quantitative resistance, which can maintain resistance durability. Therefore, we must develop molecular markers linked to the other resistant genes for the screening of germplasm to get the best use of C. fulvum resistant genes.

In this study, we identified the main physiological races of C. fulvum present in three northeast provinces (Heilongjiang, Jilin, and Liaoning) of China. The Cf-6 gene provides resistance to all prevalent physiological races of C. fulvum present in these provinces. Breeding to obtain a resistant cultivar carrying the Cf-6 gene can satisfy the demand for controlling leaf mold disease on tomatoes in these provinces. We developed molecular markers to the Cf-6 gene by the means of rapid amplification of polymorphic DNA (RAPD) and simple sequence repeat (SSR). These two methods, based on polymerase chain reaction (PCR), are easier, quicker, and simpler compared with the other molecular marking methods. The results should expedite the screening of tomato germplasm and provide the basis for isolating the Cf-6 gene.

Materials and Methods

Sources and isolation of Cladosporium fulvum.

Thirty-three C. fulvum-infected tomato leaves were collected from different tomato production fields or greenhouses in the Heilongjiang, Jilin, and Liaoning provinces. The leaves were stored at –20 °C and, before use, a 1-cm2 section was cut from each infected leaf and was immersed in 70% ethanol for 2 to 4 min, then immersed in 0.1% HgCl2 for 3 to 5 min for sterilization. The sterilized tissues were incubated on potato–dextrose–agar (PDA) medium for 8 to 10 d and the resulting isolates of C. fulvum were cultured on liquid potato dextrose medium. Next, the fungus isolates were diluted into 107 spores/mL conidial suspensions in sterile water and spread onto PDA. Using a stereomicroscope, individual spores were transferred onto PDA media for propagation. The isolated fungi were identified based on spore shape and characters to confirm that they were C. fulvum.

Identification of physiological races of C. fulvum.

The conidial suspensions were diluted to 107 spores/mL in sterile water. Tomato seedlings were inoculated by spraying conidial suspensions on the surface of leaves at the four true leaves stage. The physiological races were identified using a set of identification hosts including one series of tomato cultivars carrying different resistant genes: Money maker (Cf-0 gene), Leafmoud Resister (Cf-1 gene), Vetomold (Cf-2 gene), V121 (Cf-3 gene), Ont7516 (Cf-4 gene), Ont7517 (Cf-5 gene), and Ont7519 (Cf-9 gene). Inoculated plants were immediately placed in a humidity chamber for 72 h at 22 to 25 °C, and then were transferred onto a greenhouse bench and again kept at 22 to 25 °C. Disease severity ratings were made 15 d after inoculation. For analysis, the disease severity symptoms of the plants were converted to a disease score of 0 to 9 points where 0 point is no visible signs of infection; 1 point is 1-mm-diameter white spots or necrosis spots on the upper sides of leaves; 3 points is 2 to 3-mm-diameter yellow spots on the upper sides of leaves, some white mold on the under sides of leaves, no spores formed; 5 points is 5 to 8-mm-diameter yellow spots on the upper sides of leaves, abundant white mold on the under sides of leaves, a few spores formed; 7 points is 5 to 8-mm-diameter yellow spots on the upper sides of leaves, some black mold, many spores on the under sides of leaves, also some black mold and no spores on the upper sides of leaves; and 9 points is masses of spores formed on both sides of the leaves. Next, physiological races were determined according to the N. Hubbeling leaf mold physiological races classification method (Hubbeling, 1971). Plants with a disease score from 0 to 3 points were classified as resistant whereas those with a score of 3 to 9 points were classified as susceptible.

Extraction of tomato total genomic DNA.

Using the method of Wang and Fang (2002), 200 mg tomato leaves were ground in liquid nitrogen with a mortar and pestle. The powder was then transferred into a 1.5-mL centrifuge tube and preheated 800 μL sodium dodecyl sulfate (SDS) extraction buffer [SDS: 10 mm Tris-HCl; 50 mm ethylenediamine tetraacetic acid (EDTA); 500 mm NaCl; 10 mm β-mercaptoethanol; pH, 8.0] was added and the mixture homogenized. The centrifuge tube was incubated in a water bath at 65 °C for 1.5 h. The tube was then placed on ice immediately after incubation, 110 μl NaAc was added, and the tube was incubated on ice for 30 to 40 min. Next the tubes were centrifuged at 12,000 rpm for 20 min, the supernatant was transferred into new centrifuge tubes, and was then extracted using phenol, 1 phenol : 1 chloroform, chloroform. It was then precipitated with 2.5 volumes of ethanol and 1/5 volume of NaAc, centrifuged for 10 min at 13,000 rpm at 4 °C, and the pellet was dissolved in 40 μL double-distilled water. The quantity and quality of DNA were determined at 260 nm and 280 nm using a ultraviolet spectrometer.

Plant materials.

Resistant cultivar 03036 carrying the Cf-6 gene and susceptible cultivar 03748 were maintained in the laboratory. Cultivar 03748 was pollinated using pollen from ‘03036’ as paternal to produce F1 plants. F1 plants were also self-pollinated to produce F2 plants. F1 plants were backcrossed with ‘03748’ to obtain BC1. Parents, 10 of F1 plants and 184 of F2 plants, were grown in the greenhouse at the Horticultural Experimental Station at Northeast Agricultural Univ for artificial inoculation with C. fulvum and molecular marking analysis. The parents, F1, BC1, and F2 plants were inoculated with physiological races 1.2.3.4 using the method described earlier.

Screening of RAPD and SSR primers.

Bulked segregant analysis was used for RAPD and SSR primer screening according to Michelmore et al. (1991). The total genomic DNA of 10 resistant individuals and 10 susceptible individuals of the F2 segregating population from ‘03036’ × ‘03748’ were pooled into the resistant and susceptible bulks respectively for screening of 216 RAPD random primers and 50 SSR primers (synthesized in Shanghai Sangon Biological Engineering Technology and Service Co. Ltd, Shanghai, China). The design of SSR primers is in accordance with tomato SSR sequences in GenBank and published elsewhere (Areshchenkova and Ganal, 1999; Bredemeijer et al., 1998, 2002; Broun and Tanksley, 1996; He et al., 2003; Smulders et al., 1997; Vosman and Arens, 1997). For RAPD analysis, PCR was conducted using a 20-μL reaction system containing 200 μm each of dATP, dCTP, dGTP, and dTTP; 0.2 μm of a 10-mer oligonucleotide random primer; 0.1 μg template DNA; 0.5 U Taq DNA polymerase (Fermentas); and 2 μL 10× reaction buffer. The amplification was performed at 95 °C for 3 min, then 94 °C for 1 min, 36 °C for 1 min 30 s, 72 °C for 5 min (all 35 cycles), and 72 °C for 10 min. For SSR analysis, PCR was executed in a 20-μL reaction system containing 200 μM each of dATP, dCTP, dGTP, and dTTP; 0.1 μg template DNA; 0.2 μm primer; 0.5 U Taq DNA polymerase; and 2 μL 10× reaction buffer. Amplification was conducted at 95 °C for 3 min, then 94 °C for 1 min, 55 °C for 1 min 30 s, 68 °C for 5 min (all 35 cycles), and 68 °C for 10 min. RAPD PCR products were electrophoresed using 2% (weight/volume) agarose gel containing ethidium bromide 1.0 μg·mL–1 in 1 × TAE (40 mm Tris-acetate, 1 mm EDTA) buffer, observed under ultraviolet light and photographed. SSR PCR products were separated by polyacrylamide gel electrophoresis (6% gel) and silver stained for observation (Sambrook et al., 1989).

Conversion of the sequence characterized amplified (SCAR) marker.

The specific fragments amplified using the S374 primer were designated S374–1 and S374–2 (Fig. 1). Fragment S374–1 was only present in resistant plants; fragment S374–2 was only produced from susceptible plants. Fragments S374–1 and S374–2 were excised from agarose gel, purified by kit (Sigma-Aldrich China, Shanghai, China) and cloned into pGEM-T easy vector [Promega (Beijing) Biotech Co., Ltd, Beijing, China] for sequencing according to the manufacturer's instructions, sequenced using the ABI PRISMTM 377 automatic sequencer using M13 sequencing primers (M13 forward primer, GTAAAACGACGGCCAGT; M13 reverse primer, CAGGAAACAGCTATGAC). The specific primers (forward primer, CCCGCTAC ACCTTAAACTT; reverse primer, GCTTGGGAGATTGTGTGTAGC) for amplifying SCAR marker S374619/559 were designed according to the sequence of fragment S374–1. SCAR analysis was performed on 20 resistant individuals and 20 susceptible individuals from the F2 population. PCR was conducted for an initial step of 3 min at 94 °C followed by 40 cycles of 1 min at 94 °C, 1 min at 55 °C, 1 min at 72 °C, and a final step of 10 min at 72 °C. Agarose electrophoresis was performed as described earlier.

Fig. 1.
Fig. 1.

The RAPD PCR amplification results using S374 primers. M, molecular weight marker; 1, resistance parent ‘03748’; 2, susceptible parent ‘03036’; 3, F1 individual; 4–9, homozygous resistant F2 individuals; 10–17, heterozygous resistant F2 individuals; 18–24, homozygous susceptible F2 individuals.

Citation: HortScience horts 42, 1; 10.21273/HORTSCI.42.1.11

Data analysis.

The software Mapmaker/Exp 3.0 was used for statistical analysis of the data, and the recombination rates that were obtained were converted into genetic distance units using the Kosambi function (http://web.rhul.ac.uk/biological-sciences/Archives/Warren/calc/mapfunc.html) (Kosambi, 1944). The genetic linkage map was drawn using Mapchart 2.1.

Results and Discussion

The identification of physiological races of C. fulvum.

Thirty-three C. fulvum strains in northeast China were identified after inoculation of identification hosts. According to N. Hubbeling's C. fulvum physiological race classification method (Hubbeling, 1971), we concluded that these strains of C. fulvum belonged to physiological races 1.2.3, 1.3, 3, 1.2.3.4, and 1.2.4. The results showed that all these C. fulvum strains were highly pathogenic to all the susceptible tomato cultivars. Based on the previous results from these three northwestern provinces (Li et al., 1994), our studies show that physiological races 1.2.3.4 and 1.2.4 are new for the area. A similar situation was also found for the Beijing area in 1992 (Zhang and Fang, 1992). Our results show that some strains of C. fulvum have evolved into new physiological races and that the newly differentiated physiological races 1.2.3.4 and 1.2.4 have also become the dominant races. Physiological race 1.2.3.4 accounted for 57.6% of the strains that we collected whereas 24.2% of the strains were physiological race 1.2.4.

In only 9 years, the physiological races of C. fulvum have evolved into two new physiological races. Most likely this can be attributed to the widespread use of resistant cultivars and the characteristic of rapid differentiation of C. fulvum. The large-scale use of resistant cultivars leads to the redifferentiation of physiological races of C. fulvum. By physiological race identification, we used cultivar 03036, which has the Cf-6 gene as the molecular marker, because this resistant cultivar is resistant enough for all four physiological races found in these provinces. Because resistant cultivar 03036 often had a disease score of 3 points or less, a score of 3 points was set as the critical point for separating resistance and susceptibility.

Inheritance of the resistant gene Cf-6.

Crossing resistant cultivar 03036 and susceptible cultivar 03748, F1 resulted in progeny that were resistant to all physiological races of the pathogen. By subjecting the data to chi-square analysis, we showed that the segregation ratio of resistant individuals and susceptible individuals of the F2 population is 3:1. Resistant individuals and susceptible individuals of the BC1 population segregated according to the expected ratio of 1:1 (Table 1). Our results showed that the resistance of 03036 was controlled by one dominant gene and that it fits the monogenic Mendelian inheritance law. Cf-6 is easily used in practical breeding. Also, the Cf-6 gene may be used as a resistance gene source for gene transferring. Although Cf-6 has been listed as a dominant gene for many years, inheritance information has been lacking. Our results also confirmed that the Cf-6 gene is a single dominant gene.

Table 1.

Genetic analysis of the Cf-6 gene in different generations.

Table 1.

The screening of primers and RAPD analysis for resistant gene Cf-6.

Two pairs of bulks, including resistant bulks and susceptible bulks, were screened using 210 10-mer oligonucleotide primers according to the bulked segregant analyses (BSA) method. Three primers—S374, B-10, and N-10—were selected for further RAPD analysis. The parents, 10 F1 plants, and 184 F2 plants, were used for RAPD analysis. The inoculation results showed that all F1 plants were disease resistant and that 145 resistant plants and 39 susceptible plants were identified in 184 F2 plants. Two dominant markers and one codominant RAPD marker were found—namely, B-10, N-10, and S374619/559. The 619-bp fragment (i.e., S374–1; Fig. 1), amplified using primer S374, can be only amplified in resistant cultivar 03036 and resistant bulk, but not in susceptible cultivar 03748 or the susceptible bulk. In addition, the 559-bp fragment (i.e., S374–2; Fig. 1) can only be amplified in susceptible cultivar 03748 and susceptible bulk, not in resistant cultivar 03036 and resistant bulk. All F1 plants have two fragments whereas all F2 plants have S374–1, S374–2, or both. Obviously, the RAPD marker S374619/559 is codominant. By RAPD PCR amplification using S374, N-01, and B-10, all bands were 500 to 2000 bp in size. Linkage analysis showed that RAPD markers S374, N-01, and B-10 were 8.7 cM, 20.3 cM, and 33.4 cM apart from the Cf-6 gene.

Fig. 2.
Fig. 2.

Alignment of the nucleotide sequences of fragments S374-1 and S374-2.

Citation: HortScience horts 42, 1; 10.21273/HORTSCI.42.1.11

Generally, the RAPD marker is dominant. However, if insertion or deletion occurs in some regions of the marker, the RAPD marker can be codominant. This kind of RAPD marker has a codominant function like a restricted fragment length polymorphism (RFLP) marker, but less DNA is needed for the RAPD marker. Compared with the RFLP and Amplified fragment length polymorphism (AFLP) marking methods, the detection process of RAPD is very rapid and easy, which is very practical for breeding selection.

Conversion of RAPD markers to SCAR markers.

RAPD marker S374 mainly included two fragments: S374–1 and S374–2. The results of sequencing these two fragments showed that one insertion (34 bp) existed in the S374–1 fragment compared with the S374–2 fragment (Fig. 2). This insertion is located in the regions between 432 bp and 465 bp of the S374–1 fragment. These two fragments share 86.9% identity. To improve the specificity and stability of the RAPD marker, we converted this RAPD marker S374619/559 to SCAR marker S374619/559. The specific primers were designed for the further confirmation of SCAR marker function in marker-assisted selection (MAS). This SCAR marker is also a codominant marker, similar to RAPD marker S374619/559, named SCAR S374619/559, which was composed of the two specific fragments S374–1 and S374–2. Because specific primers were used as a SCAR marker, the SCAR marker was stable and was minimally affected by reaction conditions. Unlike the RAPD marker, the SCAR marker has few nonspecific bands. Therefore, the SCAR maker S374619/559 can be more efficient in MAS for resistance.

Fig. 3.
Fig. 3.

The PCR amplification results with SCAR primers in the F2 population. M, molecular weight marker (DL2000); 1, ‘03036’ (disease-resistant parent); 2, ‘03748’ (disease-susceptible parent); 3, F1 individual; 4–11, disease-susceptible F2 individuals; 12–15, heterozygous disease-resistant F2 individuals; 16–23, homozygous disease-resistant F2 individuals.

Citation: HortScience horts 42, 1; 10.21273/HORTSCI.42.1.11

The results of PCR amplification using SCAR primers in the F2 population showed that the resistance of most plants was cosegregated with fragment S374–1 (Fig. 3), but several plants associated with fragment S374–2 were resistant (not shown). Although gene recombination could have occurred in this study, the probability was low. The main reason may be mainly the result of the failure of artificial inoculation, which can explain the inconsistency between the SCAR test results and host inoculation results. The SCAR markers obtained in this study need to be further confirmed in a larger population.

Fig. 4.
Fig. 4.

The PCR amplification results with SSR primers T10 (A) and T12 (B) in the parents, F1 individuals and F2 populations. 1: ‘03036’ (disease resistant parent); 2: ‘03748’ (disease susceptible parent); 3: F1 individual; others: F2 individuals.

Citation: HortScience horts 42, 1; 10.21273/HORTSCI.42.1.11

Screening of SSR primers and SSR analysis for resistance.

The tomato SSRs were obtained in GenBank. Fifty pairs of SSR primers were designed according to the acquired simple repeat sequences. Two pairs of primers T10 (forward primer, CTGTTTACTTCAAGAAGGCTG; reverse primer, ACTTTAACTTTATTATTGCGACG) and T12 (forward primer, GAGCGAGCAGA AAGGTGAAT; reverse primer, GAGCCTGAAAACATAGAAGT) in 50 pairs of primers can produce stable polymorphic fragments between resistant bulk and susceptible bulk. The parents, 10 F1 plants, and 184 F2 plants that were used for the RAPD analysis were used for the SSR analysis. The analytical results with software Mapmaker/Exp 3.0 and the Kosambi function revealed that SSR markers T10 and T12 were linked to the Cf-6 resistant gene with the genetic distances of 12.6 cM and 9.7 cM respectively. Because both these two SSR markers are located in chromosome 11 (Bredemeijer et al., 2002; Smulders et al., 1997), we concluded that the Cf-6 gene is also located in chromosome 11.

SSR markers have codominance characters, so resistant and susceptible cultivars have their specific fragments, and F1 individual plants have both two specific bands from the paternal and maternal cultivars. Three kinds of polymorphic bands existed in the F2 population, which represents homozygous resistant plants, homozygous susceptible plants, and heterozygous resistant plants (Fig. 4). In this study, not many simple repeat sequences of tomato were developed; consequently; we did not determine the molecular markers linked tightly to the Cf-6 gene using the SSR method. The linkage map with the three RAPD markers and two SSR markers was obtained using Mapchart 2.1 (Fig. 5).

Fig. 5.
Fig. 5.

The genetic linkage map of RAPD markers and SSR markers, the genetic distances are shown on the left, and the name of markers are on the right.

Citation: HortScience horts 42, 1; 10.21273/HORTSCI.42.1.11

In conclusion, we developed RAPD and SSR markers. The genetic distances between the three RAPD markers and the Cf-6 gene were 8.7 cM, 20.3 cM. and 33.4 cM. Two SSR markers were 12.6 cM and 9.7 cM apart from the Cf-6 locus. One codominant RAPD marker was converted to a SCAR marker. This is the first report of molecular markers being linked to the Cf-6 locus. These markers can be used, for example, for molecular MAS. Because these markers are not linked very tightly to the Cf-6 locus, they need be used for MAS along with periodic disease resistance screening to ensure result reliability. These makers can also be used for further Cf-6 marker development and map-based gene cloning.

Literature Cited

  • Areshchenkova, T. & Ganal, M.W. 1999 Long tomato microsatellites are predominantly associated with centromeric regions Genome 42 536 544

    • Search Google Scholar
    • Export Citation
  • Bredemeijer, G.M.M. , Arens, P. , Wouters, D. , Visser, D. & Vosman, B. 1998 The use of semi-automated fluorescent microsatellite analysis for tomato cultivar identification Theor. Appl. Genet. 97 584 590

    • Search Google Scholar
    • Export Citation
  • Bredemeijer, G.M.M. , Cooke, R.J. , Ganal, M.W. , Peeters, R. , Isaac, P. , Noordijk, Y. , Rendell, S. , Jackson, J. , Röder, M.S. , Wendehake, K. , Dijcks, M. , Amelaine, M. , Wickaert, V. , Bertrand, L. & Vosman, B. 2002 Construction and testing of a microsatellite database containing more than 500 tomato varieties Theor. Appl. Genet. 105 1019 1026

    • Search Google Scholar
    • Export Citation
  • Broun, P. & Tanksley, S.D. 1996 Characterization and genetic mapping of simple repeat sequences in the tomato genome Theor. Appl. Genet. 250 39 49

    • Search Google Scholar
    • Export Citation
  • Dixon, M.S. , Jones, D.A. , Keddie, J.S. , Thomas, C.M. , Harrison, K. & Jones, J.D.G. 1996 The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins Cell 96 451 459

    • Search Google Scholar
    • Export Citation
  • Dixon, M.S. , Hatzixanthis, K. , Jones, D.A. , Harrison, K. & Jones, J.D.G. 1998 The tomato Cf-5 disease resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy number Plant Cell 10 1915 1925

    • Search Google Scholar
    • Export Citation
  • Du, Y. , Yan, Z. , Wang, X. & Li, S. 1999 Recent advances in tomato breeding. Acta Hort Sinica. 26 161 169 (in Chinese)

  • Flor, H.H. 1946 Genetics of pathogenicity in Melampsora lini J. Agr. Res. 73 335 357

  • He, C. , Poysa, V. & Yu, K. 2003 Development and characterization of simple sequence repeat (SSR) markers and their use in determining relationships among Lycopersicon esculentum cultivars Theor. Appl. Genet. 106 363 373

    • Search Google Scholar
    • Export Citation
  • Hubbeling, N. 1971 Determination trouble with new races of Cladosporium fulvum Cooke Meded. Rijksfac. Landbouwwet. Gent. 36 300 305

  • Jones, D.A. , Thomas, C.M. , Hammond–Kosack, K.E. , Balint–Kurti, P.J. & Jons, J.D.J. 1994 Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging Science 266 789 793

    • Search Google Scholar
    • Export Citation
  • Kanwar, J.S. , Kerr, E.A. & Harney, P.M. 1980a Linkage of Cfl to Cfll genes for resistance to leaf mold Cladosporiumfulvum Cke Rep. Tomato Genet. Coop. 30 20 21

    • Search Google Scholar
    • Export Citation
  • Kanwar, J.S. , Kerr, E.A. & Harney, P.M. 1980b Linkage of Cfl2 to Cf24 genes for resistance to leaf mold Cladosporiumfulvum Cke Rep. Tomato Genet. Coop. 30 22 23

    • Search Google Scholar
    • Export Citation
  • Kerr, E.A. & Bailey, D.L. 1964 Resistance to Cladosporium fulvum Cke obtained from wild species of tomato Can. J. Bot. 42 1541 1554

  • Kosambi, D.D. 1944 The estimation of map distances from recombination values Ann. Eugen. 12 172 175

  • Li, G. , Li, J. , Li, Y. , Guo, Q. & Wang, F. 1994 The preliminary studies on the differentiation of Cladosporium fulvumin 3 northeastern provinces of China J. Northeast Agr. Univ. 25 122 125 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • Meng, F. , Xu, X. & Li, J. 2005 The progress on resistance breeding of tomato leaf mold disease Chin. Agr. Sci. Bull. 21 297 301 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • Michelmore, R.W. , Paran, I. & Kesseli, R.V. 1991 Identification of markers linked to disease-resistance genes by bulked segregant analyses: A rapid method to detect markers in specific genomic regions by using segregating populations Proc. Natl. Acad. USA. 88 9828 9852

    • Search Google Scholar
    • Export Citation
  • Russell, G.E. 1978 Leaf mould 133 136 Cole D.J.A. , Haresign W. , Hudson J.P. , Russell G.E. & Tribe D.E. Plant breeding for pest and disease resistance Butterworths London

    • Search Google Scholar
    • Export Citation
  • Sambrook, J. , Fritsch, E.F. & Maniatis, T. 1989 Molecular cloning: A laboratory manual 2nd ed Cold Spring Harbor Laboratory Press Cold Spring Harbor, N.Y

    • Search Google Scholar
    • Export Citation
  • Smulders, M.J.M. , Bredemeijer, G. , Rus–Kortekaas, W. , Arens, P. & Vosman, B. 1997 Use of short microsatellites from database sequences to generate polymorphisms among Lycopersicon esculentum cultivars and accessions of other Lycopersicon species Theor. Appl. Genet. 97 264 272

    • Search Google Scholar
    • Export Citation
  • Stevens, M.A. & Rick, C.M. 1986 Genetics and breeding 67 68 Atherton J.G. & Rudich J. The tomato crop. Chapman and Hall London

  • Takken, F.L.W. , Schipper, D. , Nijkamp, H.J.J. & Hille, J. 1998 Identification and Ds-tagged isolation of a new gene at the Cf-4 locus of tomato involved in disease resistance to Cladosporium fulvum race 5 Plant J. 14 401 411

    • Search Google Scholar
    • Export Citation
  • Thomas, C.M. , Jones, D.A. , Parniske, M. , Harrison, K. , Balint–Kurti, P.J. , Hatzixanthis, K. & Jones, J.D.G. 1997 Characterization of the tomato Cf-4 gene for resistance to Cladosporium fulvum identifies sequences that determine recognitional specificity in Cf-4 and Cf-9 Plant Cell 9 2209 2224

    • Search Google Scholar
    • Export Citation
  • Thomma, B.P.H.J. , van Esse, H.P. , Crous, P.W. & de Wit, P.J.G.M. 2005 Cladosporium fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model for functional studies on plant pathogenic Mycosphaerellaceae Mol. Plant Pathol. 6 379 393

    • Search Google Scholar
    • Export Citation
  • Vosman, B. & Arens, P. 1997 Molecular characterization of GATA/GACA microsatellite repeats in tomato Genome 40 25 33

  • Wang, G. & Fang, H. 2002 Plant gene engineering 742 744 2nd ed China Science Press Beijing (in Chinese)

  • Zhang, H. & Cai, M. 1992 The studies on the re-differentiation of tomato leaf mold physiological races in Beijing area China Vegetable. 2 1 3 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • Zhang, H. & Cai, M. 1999 Studies on physiological races of tomato leaf mould and their differentiation in Beijing Acta Agr. Boreali-Sinica. 14 113 118 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • View in gallery

    The RAPD PCR amplification results using S374 primers. M, molecular weight marker; 1, resistance parent ‘03748’; 2, susceptible parent ‘03036’; 3, F1 individual; 4–9, homozygous resistant F2 individuals; 10–17, heterozygous resistant F2 individuals; 18–24, homozygous susceptible F2 individuals.

  • View in gallery

    Alignment of the nucleotide sequences of fragments S374-1 and S374-2.

  • View in gallery

    The PCR amplification results with SCAR primers in the F2 population. M, molecular weight marker (DL2000); 1, ‘03036’ (disease-resistant parent); 2, ‘03748’ (disease-susceptible parent); 3, F1 individual; 4–11, disease-susceptible F2 individuals; 12–15, heterozygous disease-resistant F2 individuals; 16–23, homozygous disease-resistant F2 individuals.

  • View in gallery

    The PCR amplification results with SSR primers T10 (A) and T12 (B) in the parents, F1 individuals and F2 populations. 1: ‘03036’ (disease resistant parent); 2: ‘03748’ (disease susceptible parent); 3: F1 individual; others: F2 individuals.

  • View in gallery

    The genetic linkage map of RAPD markers and SSR markers, the genetic distances are shown on the left, and the name of markers are on the right.

  • Areshchenkova, T. & Ganal, M.W. 1999 Long tomato microsatellites are predominantly associated with centromeric regions Genome 42 536 544

    • Search Google Scholar
    • Export Citation
  • Bredemeijer, G.M.M. , Arens, P. , Wouters, D. , Visser, D. & Vosman, B. 1998 The use of semi-automated fluorescent microsatellite analysis for tomato cultivar identification Theor. Appl. Genet. 97 584 590

    • Search Google Scholar
    • Export Citation
  • Bredemeijer, G.M.M. , Cooke, R.J. , Ganal, M.W. , Peeters, R. , Isaac, P. , Noordijk, Y. , Rendell, S. , Jackson, J. , Röder, M.S. , Wendehake, K. , Dijcks, M. , Amelaine, M. , Wickaert, V. , Bertrand, L. & Vosman, B. 2002 Construction and testing of a microsatellite database containing more than 500 tomato varieties Theor. Appl. Genet. 105 1019 1026

    • Search Google Scholar
    • Export Citation
  • Broun, P. & Tanksley, S.D. 1996 Characterization and genetic mapping of simple repeat sequences in the tomato genome Theor. Appl. Genet. 250 39 49

    • Search Google Scholar
    • Export Citation
  • Dixon, M.S. , Jones, D.A. , Keddie, J.S. , Thomas, C.M. , Harrison, K. & Jones, J.D.G. 1996 The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins Cell 96 451 459

    • Search Google Scholar
    • Export Citation
  • Dixon, M.S. , Hatzixanthis, K. , Jones, D.A. , Harrison, K. & Jones, J.D.G. 1998 The tomato Cf-5 disease resistance gene and six homologs show pronounced allelic variation in leucine-rich repeat copy number Plant Cell 10 1915 1925

    • Search Google Scholar
    • Export Citation
  • Du, Y. , Yan, Z. , Wang, X. & Li, S. 1999 Recent advances in tomato breeding. Acta Hort Sinica. 26 161 169 (in Chinese)

  • Flor, H.H. 1946 Genetics of pathogenicity in Melampsora lini J. Agr. Res. 73 335 357

  • He, C. , Poysa, V. & Yu, K. 2003 Development and characterization of simple sequence repeat (SSR) markers and their use in determining relationships among Lycopersicon esculentum cultivars Theor. Appl. Genet. 106 363 373

    • Search Google Scholar
    • Export Citation
  • Hubbeling, N. 1971 Determination trouble with new races of Cladosporium fulvum Cooke Meded. Rijksfac. Landbouwwet. Gent. 36 300 305

  • Jones, D.A. , Thomas, C.M. , Hammond–Kosack, K.E. , Balint–Kurti, P.J. & Jons, J.D.J. 1994 Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by transposon tagging Science 266 789 793

    • Search Google Scholar
    • Export Citation
  • Kanwar, J.S. , Kerr, E.A. & Harney, P.M. 1980a Linkage of Cfl to Cfll genes for resistance to leaf mold Cladosporiumfulvum Cke Rep. Tomato Genet. Coop. 30 20 21

    • Search Google Scholar
    • Export Citation
  • Kanwar, J.S. , Kerr, E.A. & Harney, P.M. 1980b Linkage of Cfl2 to Cf24 genes for resistance to leaf mold Cladosporiumfulvum Cke Rep. Tomato Genet. Coop. 30 22 23

    • Search Google Scholar
    • Export Citation
  • Kerr, E.A. & Bailey, D.L. 1964 Resistance to Cladosporium fulvum Cke obtained from wild species of tomato Can. J. Bot. 42 1541 1554

  • Kosambi, D.D. 1944 The estimation of map distances from recombination values Ann. Eugen. 12 172 175

  • Li, G. , Li, J. , Li, Y. , Guo, Q. & Wang, F. 1994 The preliminary studies on the differentiation of Cladosporium fulvumin 3 northeastern provinces of China J. Northeast Agr. Univ. 25 122 125 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • Meng, F. , Xu, X. & Li, J. 2005 The progress on resistance breeding of tomato leaf mold disease Chin. Agr. Sci. Bull. 21 297 301 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • Michelmore, R.W. , Paran, I. & Kesseli, R.V. 1991 Identification of markers linked to disease-resistance genes by bulked segregant analyses: A rapid method to detect markers in specific genomic regions by using segregating populations Proc. Natl. Acad. USA. 88 9828 9852

    • Search Google Scholar
    • Export Citation
  • Russell, G.E. 1978 Leaf mould 133 136 Cole D.J.A. , Haresign W. , Hudson J.P. , Russell G.E. & Tribe D.E. Plant breeding for pest and disease resistance Butterworths London

    • Search Google Scholar
    • Export Citation
  • Sambrook, J. , Fritsch, E.F. & Maniatis, T. 1989 Molecular cloning: A laboratory manual 2nd ed Cold Spring Harbor Laboratory Press Cold Spring Harbor, N.Y

    • Search Google Scholar
    • Export Citation
  • Smulders, M.J.M. , Bredemeijer, G. , Rus–Kortekaas, W. , Arens, P. & Vosman, B. 1997 Use of short microsatellites from database sequences to generate polymorphisms among Lycopersicon esculentum cultivars and accessions of other Lycopersicon species Theor. Appl. Genet. 97 264 272

    • Search Google Scholar
    • Export Citation
  • Stevens, M.A. & Rick, C.M. 1986 Genetics and breeding 67 68 Atherton J.G. & Rudich J. The tomato crop. Chapman and Hall London

  • Takken, F.L.W. , Schipper, D. , Nijkamp, H.J.J. & Hille, J. 1998 Identification and Ds-tagged isolation of a new gene at the Cf-4 locus of tomato involved in disease resistance to Cladosporium fulvum race 5 Plant J. 14 401 411

    • Search Google Scholar
    • Export Citation
  • Thomas, C.M. , Jones, D.A. , Parniske, M. , Harrison, K. , Balint–Kurti, P.J. , Hatzixanthis, K. & Jones, J.D.G. 1997 Characterization of the tomato Cf-4 gene for resistance to Cladosporium fulvum identifies sequences that determine recognitional specificity in Cf-4 and Cf-9 Plant Cell 9 2209 2224

    • Search Google Scholar
    • Export Citation
  • Thomma, B.P.H.J. , van Esse, H.P. , Crous, P.W. & de Wit, P.J.G.M. 2005 Cladosporium fulvum (syn. Passalora fulva), a highly specialized plant pathogen as a model for functional studies on plant pathogenic Mycosphaerellaceae Mol. Plant Pathol. 6 379 393

    • Search Google Scholar
    • Export Citation
  • Vosman, B. & Arens, P. 1997 Molecular characterization of GATA/GACA microsatellite repeats in tomato Genome 40 25 33

  • Wang, G. & Fang, H. 2002 Plant gene engineering 742 744 2nd ed China Science Press Beijing (in Chinese)

  • Zhang, H. & Cai, M. 1992 The studies on the re-differentiation of tomato leaf mold physiological races in Beijing area China Vegetable. 2 1 3 (in Chinese)

    • Search Google Scholar
    • Export Citation
  • Zhang, H. & Cai, M. 1999 Studies on physiological races of tomato leaf mould and their differentiation in Beijing Acta Agr. Boreali-Sinica. 14 113 118 (in Chinese)

    • Search Google Scholar
    • Export Citation
Aoxue WangDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Aoxue Wang in
Google Scholar
Close
,
Fanjuan MengDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Fanjuan Meng in
Google Scholar
Close
,
Xiangyang XuDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Xiangyang Xu in
Google Scholar
Close
,
Yong WangDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Yong Wang in
Google Scholar
Close
, and
Jingfu LiDepartment of Vegetable Science, College of Horticulture, Northeast Agricultural University, Harbin, China 150030

Search for other papers by Jingfu Li in
Google Scholar
Close

Contributor Notes

This work was supported by China National “863” Hi-Tech Grant (2001AA241122).

We appreciate Dr. Jack Sutherland's help in reading and revising this manuscript.

The first two authors contributed equally to this work.

Current address: College of Life Science, Northeast Forest University, Harbin, China 150080.

To whom reprint requests should be addressed; e-mail lijingfu_hort@yahoo.com.cn

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 182 175 15
PDF Downloads 187 174 14
Save